Question

Which of the following statements is correct?

Group of answer choices

Veins carry blood away from the heart

A stenotic heart valve would restrict the flow of blood through the valve

Semilunar valves are located between the atria and the ventricles

The right ventricle pumps blood to the systemic circulation

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Animal Physiology and Biochemistry

Related Biology Q&A

Find answers to questions asked by students like you.

Q: How is the large size of some cephalopods related to the type of circulatory system they present?

A: Cephalopods include squid, octopus, and nautilus that belong to the class Cephalopoda and the phylum...

Q: Do Prokaryotes have sets of chromosomes like we do?

A: Prokaryotes are the organisms that lack a well-developed nucleus. They do not have membrane-bound or...

Q: what  muscle or muscles may be strained if a patient complains of pain of the following locations: M...

A: Muscle is a soft tissue found in most animals and contain protein filaments of actin and myosin. The...

Q: This virtual lab was testing for lupus. How is this same test used to test for the presence of HIV? ...

A: Lupus is a disease in which the immune system abnormally becomes hyperactive and attacks the normal ...

Q: Describe the basics of enzyme structure and function. Be sure to address what makes enzymes specific...

A: Enzymes are proteins that accelerate chemical reactions that otherwise would proceed too slowly to s...

Q: WRITE ABOUT A THEME: INTERACTIONS One factorfavoring rapid population growth by an introduced specie...

A: Natural selection is a method by which an organism is selected on the basis of its ability to surviv...

Q: Below are gel electrophoresis results for initial and nested PCR of the Shrimp Plant. Use the result...

A: Electrophoresis is the process of separation of molecules on the basis of their charge/mass ratio us...

Q: Can drinking 1-2 cups of coffee (caffeine) cause hypertension? Cam escessive salt intake cause it?

A: Since you have posted multiple questions, we will solve the first question for you. To get the remai...

Q: ELISA TEST WOULD PROVIDE ME THE PRESENCE OF ANTIGENS FROM THE INFLUENZA A VIRUS?

A: ELISA or Enzyme Linked Immunosorbent Assay is based on the principle of antigen-antibody interaction...

Q: What is aquaculture?

A: The method of sexual reproduction that produces offspring is called breeding. The care of offspring ...

Q: Which product of apiculture is used in cosmetics and polishes?

A: Apiculture is the cultivation of bees for commercial production of honey.

Q: In the introduction to this chapter, we discussed the role of famine during early prenatal developme...

A: The central nervous system (CNS) appears at the beginning of the third week as a slipper-shaped plat...

Q: List the four stages of aerobic cellular respiration.  In addition, for each stage list the amount o...

A: The process by which organisms break down glucose into a form that the cell can use as energy is kno...

Q: List the three major classes of segmentation genes and outline the function of each.

A: Segmentation means dividing the embryo into even smaller segments. the specific structures are then ...

Q: All the organisms on your campus make up(A) an ecosystem.(B) a community.(C) a population.(D) a taxo...

A: An ecosystem contains living as well as non living components which interact with each other. This o...

Q: Listen 98 74 Endocytosis Key Idea: Endocytosis is an active transport process in which the cell engu...

A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as th...

Q: Describe the structure of a non-enveloped virus and an enveloped virus.  Be sure to address the caps...

A: Viruses are obligate acellular parasites that requires a living cell of the host for its multiplicat...

Q: How are natural and artificial pearls created?

A: The biology is a branch of science that studies about the living organisms. The biology studies abou...

Q: What role does the spleen play during a malaria infection? How does this contribute to some of the h...

A: Malaria is caused due to a protozoan called Plasmodium species. This disease is characterized by the...

Q: Do echinoderms have an excretory system? How is excretion done in these animals?

A: We answer only the first question as you have posted multiple choice questions. If you need help wit...

Q: Which of the following types of vessels is not found in the lymph system? Group of answer choices Ve...

A: In addition to the circulatory system which consists of blood vessels and ducts, there is another sy...

Q: In preparing a site for surface mining and later restoration, why wouldengineers separate the topsoi...

A: Restoration ecology is a branch of ecology that deals with the restoration of the degraded, damaged ...

Q: Brain and RBCs mainly use glucose as an energy source. Explain why and what pathways/mechanisms do t...

A: Energy is essential for the normal functioning of the organs in the body. Generally, many tissues us...

Q: A roan cow is crossed with a roan bull   2nd Question to answer ---- How many of the offspring could...

A: codominance is a condition where alleles A and B can equally express themselves in oder to give a ph...

Q: Are mollusc metameric beings? Exclusively analyzing this feature could it be said that molluscs are ...

A: The mollusks are a diverse group containing 85,000 species. These are mostly marine species.

Q: what are some of the properties of mold that make them sometimes beneficial to humans, and sometimes...

A: Molds are fungi that are microscopic in size. Even though they can approximate bacteria in size, mol...

Q: What percentage of the solar energy that reaches the marsh is incorporated into gross primary produc...

A: the amount of energy that is passed from one trophic level to the next is called the ecological effi...

Q: Several generations of population X have been studied.  The dominant allele frequency for the second...

A: The dominant allele frequency for the 2nd generation of population X was 0.31. The dominant allele f...

Q: Identify three things you need to know about an organism in order to use it for an experiment.

A: The organisms that are widely used for experimental purposes are called model organisms.

Q: Scientists often talk about the evidence for evolution.  Using the five types of evidence listed her...

A: Evolution is an orderly change from one form to another. The study of history of life forms is known...

Q: Give a short note on phytophagous animals with example.

A: 'Phyto' means plant and 'phagous' means eater. So, phytophagous means plant-eater.

Q: Give some example of breed and species?

A: A group of animals possessing similar general appearance, features, size, configuration, etc. are sa...

Q: Which of the following statements best distinguisheshypotheses from theories in science?(A) Theories...

A: What is hypothesis? Hypothesis is an idea that is suggested as the possible explanation for somethin...

Q: The researchers found that the Neanderthal fossil had approximately0.0078 as much 14C as found origi...

A:   a. The half live can be calculated  using the formula- N=N0(1/2)n where, n = number of half lives,...

Q: Do octopus and squids have exoskeleton?

A: An exoskeleton is an outer cover present on the body of an animal. In most of the animals it is made...

Q: Semi-dwarf varieties of a crop plant ere derived fromIR-8 name that crop?

A: As name suggests, a dwarf variety refers to a plant that grows to a lesser height than usual for its...

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom ...

A: Transcription is the first step of central dogma or simply gene expression in which the DNA sequence...

Q: Besides obesity, give the other two possible causes of OBS.                                 read the...

A: Hi! We don't answer questions using external references. Hence, I will be answering the question for...

Q: On the image of the kidney, identify the structures or regions indicated below: B D A

A: The kidney is the main organ concerned with excretory system of the human body. They help in removin...

Q: What holds the atoms together in a crystal of magnesiumchloride (MgCl2)?

A: Chemical Bonding is the process of formation of a chemical bond between two or more atoms, molecules...

Q: Why is the color blindness gene still common in today's population?

A: Color blindness: It is a genetic disease caused due to mutations on the X-chromosome. color blindnes...

Q: Explain how could determine resting heart rate (pulse rate) based on meaurements from a peripheral a...

A: The blood forced into the aorta during systole not only moves the blood in the vessels forward but a...