Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand? Select one: O a. UUU O b. AUG O c. UCU O d. CCU O e. UGA
Q: How many moles of EDTA (C10H16N2O3) do you have in 785µl of a 74MM EDTA solution (Mr(C10H16N203) =…
A:
Q: This type of fertilization happens when the sperm is introduced inside the female body through…
A: The process of fusion of sperm with egg (ovum) to produce zygote is called fertilization.
Q: Question: please provide your thoughts on whether or not melatonin seems to be a good option for…
A: Melatonin occurs naturally in both plants and mammals. Long associated with the regulation of the…
Q: DUST PARTICLES HAVING MICROSCOPIC SIZE (0.25-10MKM) 1. quickly within a few minutes settle according…
A: According to the dispersity, dust particles are comprised of different sizes- visible (greater than…
Q: What is the mode of inheritance shown in this pedigree? II 1 3. 6. 7. 2 3 5 6 7 8 9 10 IV 1 2 3 5 67…
A: Since they lack a second copy of the X chromosome to give a dominant allele, any XY individual who…
Q: To explain: Whether both v-SNARES and t- SNARES are essential for the homotypic fusion.
A: When two membranes merge that are of the same type, such as vacuole to vacuole fusion, homotypic…
Q: Endosymbiosis states that free-living [ ? ] were engulfed J of and became the [ ]of the eukaryotes…
A: Introduction :- Endosymbiosis occurs when one cell engulfs another, resulting in a coevolved…
Q: From the cross TtYyRr x ttYyrr, calculate the proportion of offspring that would match the following…
A: A trait is a characteristic features that is unique to particular individual . A trihybrid cross is…
Q: How do you identify Enterobacter aerogenes for the Urea test?
A: Enterobacter aerogenes are gram negative;motile;rod shaped bacteria which are responsible for…
Q: The gram negative unknown organism that is Enterobacter aerogenes? What kind of the shape of…
A: Enterobacter aerogenes is a proteobacteria which belongs to Enterobacteriales and family…
Q: i need the answer quickly
A: Dust is of following types: - Visible Microscopic Ultra Microscopic Visible is filtered out at the…
Q: 1. What would be the effect if all parasitic invertebrates become extinct? Would there be an effect…
A: Parasites are organisms that depend on the organisms to feed and live. Parasites are categorised…
Q: 1. Both parents have one dominant allele and one recessive allele. This means that they are…
A: Note: since you have mentioned "1". So, we will be answering the only first question for you. Thank…
Q: Energy is released reactants AG <0 products Time This graph shows an reaction. Gibbs Free Energy
A: This graph showing exothermic reaction.
Q: List and briefly define the 5 major types of cell attachments in animal cells.
A: Cell attachment is the first step in a process of compartment interactions that are essential for…
Q: Compare and contrast the views of animal evolution based on body plan characteristics to those based…
A: When the anatomical or physical traits are considered for the determination of evolution then the…
Q: Phosphorylase kinase integrates signals from thecyclic-AMP-dependent and Ca2+-dependent…
A: Phosphorylase kinase which is abbreviated as PhK, has the responsibility to coordinate hormonal as…
Q: need help with microbiology/2010 1. Describe where the following items should be discarded: a)…
A: There are two types of bacteria: Gram-negative Gram-positive
Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: II. The base composition of a single stranded DNA, which is 1000 bases long is the following: A =…
A: A parent DNA molecule makes two DNA double helix in a single round of DNA replication.
Q: 1. This type of fertilization happens when the sperm is introduced inside the female body through…
A: Fertilization It is defined as the process of the fusion of sperm with the egg. The fusion results…
Q: B. Describe the following common patterns of inheritance in humans and give two human disorders for…
A: Understanding disease transmission patterns requires an understanding of basic inheritance laws.…
Q: You are walking to class, pondering the intricacies of physiology, when you trip over an uneven…
A: The largest part of the brain is cerebrum. It is divided into two hemispheres, or halves, called the…
Q: Barr bodies inactivate Xic on autosomes. O are formed in female somatic cells O are formed in female…
A: Barr bodies is an inactivated X-chromosome. It is present in a cell that contains more than one…
Q: 4. Describe the process of alternation of generations using any plant phylum as an example. In your…
A: Introduction :- In plants and algae, the most common type of life cycle is generational alternation.…
Q: 3. In excitable cells, depolarization is most closely associated with which of the following events?…
A: INTRODUCTION A neuron is the basic functional structure of the central nervous system. Neurons are…
Q: VENTILATION FOR PREVENTING PROPAGATION OF POLLUTANTS THROUGHOUT THE ROOM 1. aeration 2. general…
A: Pollutants are defined as the elements or particles that are major contributors to pollution. These…
Q: n the grouping of cnidarians and ctenophorans in a single phylum before? What were the reasons why…
A: 2. Cnidarians and Ctenophorans are multicellular animals. Both have tissue level of organisation and…
Q: Dropping Mercury Electrode
A:
Q: 4. Mr. Salazar has Type A blood while Mrs. Salazar has Type B. They have four children. Bobbie has…
A: Given - Blood type of Mr Salazar - A Blood type of Mrs Salazar - B Therefore, Possible genotypes of…
Q: Please discuss the value of international normalized ratio (INR) as a test. Why do you think this is…
A: PT test is the normal blood test conducted to record the time taken for blood to clot.
Q: 3. Estimate the flow resistance in a small arteriole (lumen diameter 25 microns; length 0.1 cm) for…
A: Introduction The proportion of red blood cells in your blood is measured by a hematocrit test. Your…
Q: Venous System a. How does the blood in the pulmonary vein differ from that in other veins? b. Name…
A: All vertebrates' circulatory systems are dominated by veins and arteries. With each heartbeat, they…
Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…
A:
Q: ANSWER THESE QUESTION; Click Edit DNA and make a substitution mutation that changes the first base…
A: Original sequence- ATG CCA GGC GGC GAG AGC TTG CTA ATT GGC TTA TAG Edited sequence- changes the…
Q: 2. Why do we use samples in the collection of data?
A: Introduction Scientific data:- It is defined as information collected using particular methods for a…
Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…
A: There are different kind of interactions occurs in diverse organisms in the environment;which affet…
Q: Reproduction that involves two parents is called. Asexual reproduction Behaviour Genetics Sexual…
A: Biology is the study of life or living matter in all of its forms and manifestations, with a focus…
Q: Which of the following would NOT leac protein denaturation? A. A pH change B. A covalent compound C.…
A: In biology, denaturation is the modification of a protein's molecular structure. Many of the weak…
Q: Given the following information about the inheritance of characteristics in pea plants, answer the…
A: 1. Different gametes produced by the female plant= yyRrBbssll Using formula = 2n n= number of…
Q: Explain in 3 paragraphs what is coevolution and its types (pairwise, diffuse, and genefor gene…
A: Coevolution It is defined as the process of evolution of two species in a mutually dependent…
Q: A protein molecule composed of a sequence of polar amino acids, shown in blue, and a sequence of…
A: Phospholipids are the amphipathic molecules that make the lipid bilayers of the plasma membrane.
Q: Ray-finned fish Rodents & rabbits Crocodiles Birds Sharks Amphibians Primates Hair Eggs with shelle…
A: The phylogeny tree is given in the image. It depicts the relationship between the taxons present in…
Q: - Coronary arteries route oxygen rich blood into the tissues of the heart. of the: d. descending…
A: Two major coronary arteries branch off from the aorta. They branch off from a point where aorta…
Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…
A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…
Q: Q4) The relative volume of red blood cells can be known by measuring the hematocrit (the ratio…
A: Blood It is a type of connective tissue that connects whole body. It carry oxygen to every cell of…
Q: similarities and differences of nervous system and endocrine system
A: Organ system: The biological system consisting of a group of organs that work together to perform…
Q: Use a cost–benefit approach to explain why females whose eggs are destroyed still remain with the…
A: Social animals often form long-lasting relationships with fellow group members, usually with…
Q: Give an example of a physiological adaptation using organs and/or tissues of an organism of your…
A: A metabolic or physiologic adjustment within an organism's cell or tissues in response to an…
Q: To determine: The percentage of women who were not infected with any type of cancer-causing HPV who…
A: In this study, the researchers aimed to establish a link between the prevalence of multiple HPV…
Step by step
Solved in 2 steps
- The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’A DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA molecule? 5’ AACGTAACG 3’ 5’ UUGCAUUGC 3’ 5’ TTGCATTGC 3’ 5’ UUGCAUUGC 3’
- If a DNA strand with the sequence GGCATGCCTATGCGA is transcribed, which of the following accurately represents the newly synthesized mRNA strand? Question 10 options: GGCATGCCTATGCGA CCGTACGGATACGCT CCGUACGGAUACGCUIf a DNA strand with the sequence GAT TAC GGG ATA GCG is transcribed, which of the following accurately represents the newly synthesized mRNA strand? Question 10 options: GAT TAC GGG ATA GCG CTA ATG CCC TAT CGC GUA AUC GGG UAU GCG CUA AUG CCC UAU CGCIf a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be? I chose b and got this questions wrong, why is this wrong? a. The mRNA would not properly exit the nucleus. b. The mRNA would not properly bind to a ribosome. c. The mRNA would not receive a poly A tail. d. The mRNA would not use the correct start codon. e. Both a and b are correct.
- Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome: Choose the sequence that would correspond to that mRNA. A: 3’ – TACGGAACG – 5’ B) 3’ – AUGCCUUGC – 5’ C) 5’ – AUGCCUUGC – 3’ D) 3’ – UACGGAACG – 5’ E) 5’ – UACGGAACG – 3’Use the following information to answer the next two questions.A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. AUG CCC UUG GUC b. CGT AAA CCA ACT c. AUC GGG UUG GUC d. GCU AAA CCA ACU
- Following transcription, the RNA has a complementary sequence of which of the following?Question 9 options: A) regulatory sequences B) termination sequences in the coding strand of DNA C) the template strand of DNA D) none of the answers are correctA CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript produced from this section of the DNA be? Group of answer choices 3' AUGCCG 5' 5' AUGGCC 3' 3' UACGGC 5' 5' UACGGC 3' 5' TACGGC 3' 5' AUGCCG 3'If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above