Which substance is a molecule rather than an element? O hydrogen carbon dioxide O phosphorous O aluminum

Q: A doctor prescribes an ointment that is 2% hydrocortisone. A pharmacist has 1% and 5% concentrations…

A: Given that the pharmacist has pintments of 1% and 5 % concentrations. We have to make a 1 ounce tube…

Q: Animal fats for saturated fats are liquid at room temperature and include foods like olive oil, fish…

A: 2. Fats are an essential macronutrient that are important for many bodily functions, such as…

Q: Respiratory droplets and aerosols are the same thing.   Question 19 options:   a) True   b) False

A: ANSWER) Aerosols are the smallest units of droplets, many aerosols come together to form a droplet.…

Q: Palivizumab is a humanized monoclonal anitbody for the prohylaxis of resporatory diseases caused by…

A: Palivizumab is a humanized monoclonal anitbody developed to help protect against respiratory…

Q: Is glucose into the cell facilitated diffusion or active transport

A: Glucose cannot diffuse directly into cells but enters by a transport mechanisms: Na+ -independent,…

Q: r boss has invented three supplements that have been proven to impact metabolism, and she is trying…

A: Glucose is a Carbohydrate and it provides energy by the process of glycolysis or by aerobic…

Q: What is knockdown gene analysis? How is this different from knockout analysis?

A: Gene knockdown is a method in which temporarily stop or decrease the expression of one or more…

Q: Dihybrid Crosses - Genotypes NOW YOU KNOW THE RULES - FOR EACH PHENOTYPE SHOWN IN THE PICTURES, WORK…

A: Introduction A gene exists in two alternative forms known as allele. When both the alleles are same,…

Q: Evaluate the suitability of DNA and RNA as genetic material and justify the suitability of the one…

A: DNA stands for the Deoxyribonucleic acid and RNA stands for the Ribonucleic acid.Genetic material is…

Q: In relation to NSAIDs, describe the mechanism of how tissue damage leads to pain and how NSAIDs,…

A: Nonsteroidal anti-inflammatory drugs, or NSAIDs, are a widely used class of medications that are…

Q: 3. Using this chart as support, explain why most plants, algae, and photosynthetic bacteria appear…

A: ANSWER) Photosynthesis is the process by which the plants, cyanobacteria and algae use the carbon…

Q: Can you Describe in 1500 words, Planning Cycle for a Health Program?

A: Health program basically means to provide basic preventive ideas to prevent the spread of…

Q: Label the 5' end and the 3' end of the future polymer and explain why this is the case 0 61810 6 CH₂…

A: In molecular biology and biochemistry, the 5' end and 3' end of a nucleic acid polymer refer to the…

Q: structure A. Proteins are made up of Each one can be called a and the peptide chain of amino acids…

A: The three-dimensional configuration of an amino acid-chain molecule's atoms is known as protein…

Q: During the action potential waveform, the voltage returns to the resting membrane potential at -70mV…

A: An action potential is a rapid change in the electrical potential of a cell membrane, caused by the…

Q: What is this type of image called? How are they useful? What disorder does this person have? How can…

A: We know that a chromosome is an organized structure of DNA and protein that is found in nucleus. The…

Q: Explain and demonstrate the steps in DNA replication using a replication fork.  Replicate 10…

A: DNA is a  double stranded molecule made by nucleotides of which opposite strands are linked rogether…

Q: How is it possible for aphids to feed only on the carbohydrate-rich but nutrient-poor sap of phloem…

A: Microbiology: The science of micro creatures' biology includes viruses, bacteria, algae, fungus,…

Q: Transcription start site selection by S. cerevisiae Pol II occurs over a range of positions located…

A: Introduction: Transcription start sites (TSSs) are acquired by RNA polymerase II (Pol II) in…

Q: What happens when large natural and/or man-made deforestation occur? How does the plant control the…

A: The epidermis of plant cells has specialized openings called stomata. They are crucial to the carbon…

Q: 3. Beetles of a certain species may have green, blue, or turquoise wing covers. Virgin beetles were…

A: Gene It refers to the basic unit of heredity which is passed from parent to progeny. It constitutes…

Q: Mendel found that crossing wrinkle-seeded (rr) plants with homozygous round-seeded (RR) plants…

A:

Q: In a clinical trial it might seem unethical to compare a drug candidate versus a placebo rather than…

A: The term “Placebo” refers to a substance that is manufactured to have no therapeutic value. For…

Q: 8. Evolutionary biologists can estimate when major clades probably diverged from each other using…

A: Clade analysis can aid in conservation biology. By understanding the evolutionary history and…

Q: 4.2 Answer these "a, b, c" questions, well detailed with a lot of information filled in. It is…

A: Beluga whales are a unique and fascinating species that are found in Arctic and sub-Arctic waters.…

Q: 1. Following Glycolysis, the second stage of cellular respiration is the Krebs (or citric acid)…

A: The Krebs cycle or TCA cycle or tricarboxylic acid cycle or Citric acid cycle is a series of enzyme…

Q: The waved albatross feeds exclusively on marine organisms and has no access to fresh water. It has…

A: Albatrosses have salt glands just behind their eye sockets. This salt gland allows them to get rid…

Q: a) What molecule is released after the nucleotides are linked via a phosphodiester bond? b) What do…

A: DNA (Deoxyribonucleic acid) is the genetic material in most of the organisms. It is a double…

Q: We know that there are several risk factors for cancer, which of those risk factors are significant…

A: Cancer results from the uncontrolled cell division. Sometimes during cell division when the…

Q: Which of the following cannot be seen by astronauts in the International Space Station with their…

A: Space research has many benefits for humanity. One of the main benefits is that it allows us to…

Q: Let's Think Critically 1. Why do autumn leaves turn yellow and fall? 2. What happens when large…

A: Introduction:- There are different types of plant growth regulators or plant hormones that controls…

Q: What is the optimal pH range for (PACI) coagulant?

A: A coagulant is a chemical that is generally used in water treatment to remove suspended solids in…

Q: how might you apply Kochs postulates to a pathogen that will not grow on culture media?

A: The organism which cause disease in its host is known as pathogen. Pathogen are those microorganisms…

Q: 23: Vmax, the maximum velocity, of an enzyme-catalyzed reaction is: A) The rate observed when all…

A: In living beings there are a complex nitrogen-containing molecules are called enzymes. These…

Q: When a food handler doesn't wash their hands after using the bathroom and introduces noravirus…

A: Introduction  Any change in the body's physicality or function causing discomfort or disability is…

Q: A person infected with an infectious agent, able to transmit disease but is asymptomatic without any…

A: Several bacteria, viruses and parasites can cause harmful infectious disease. It is important to…

Q: options:   Water volume positively affected the growth of tomato plants in section 1 of the garden…

A: Fertilizer B worked the best.  The tomato plants in this section of the garden grew the least after…

Q: Penicillium chrysogenum Morphology Picture attached. Description : 1. Conidium 2. Sterigmata 3.…

A: Penicillium notatum is a type of fungi.It comes under phylum ascomycetes.It can reproduce by all…

Q: 1.2 Answer these "a, b, c" questions, well detailed with a lot of information filled in. It is…

A: Marine creatures such as beluga whales are critical to the health and balance of marine ecosystems,…

Q: Fill in the blank with the most appropriate response: Regardless of discipline, __________ is…

A: Regardless of discipline testing hypotheses is central to all modes of scientific inquiry

Q: 3. Why is rubisco considered to be the most important enzyme on earth? What does it do?

A: Introduction:- Ribulose-1,5-bisphosphate carboxylase/oxygenase, commonly known as rubisco is an…

Q: Direction: Read the following information and fill in the blanks. Water moves through membranes by…

A: In osmosis,water moves from region of higher water concentration  to the region of lower water…

Q: identify the vegetative propagule of eichormia.

A: Vegetative propagation is the process of asexual reproduction in plants. The process in which new…

Q: explain how one would determine which strand is leading and which strand is lagging in the…

A: Introduction DNA acts as a genetic material in our body. DNA is a self replicating molecule. DNA…

Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…

A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…

Q: Questions 1. Who are the characters in this real-life scenario? What medical situation does each of…

A: We all know that our all physiological information are stored in our genetic material,DNA.But if…

Q: Curator makes a goo (c) Calculate the enthalpy of combustion for ethanol using bond energies and…

A: Burning some materials at high temperatures is referred to as combustion. A gaseous material (smoke)…

Q: Procedure Water Fill a cup with 1/2 cup water. Add a few drops of blue food coloring to the cup.…

A: The hydrogen atom's electron density is drawn away from it by the oxygen atom of an alcohol's…

Q: Explain the importance of differential gene expression. Why don't cells and organisms simply express…

A: Gene expression is the process by which a gene's information is used to create a functional gene…

Q: Explain how a transcriptional fusion to a reporter gene, combined with site directed mutagenesis,…

A: Studies of gene expression and promoter activity are frequently made easier with the aid of gene…