Why is an early diagnosis of developmental dysplasia of the hip imperative?

Q: Maximum of 5 sentences: a. What limits a size of the cell and why? b. Describe the relationship of…

A: Introduction  The fundamental building blocks of life are microscopic structures called cells. Even…

Q: According to the graphical theory of life history evolution, describe the shape of the trade-off…

A: A group of creatures that can breed with one another in nature and create healthy offspring is…

Q: Instruction: Read the theory below and formulate a hypothesis based on the theory. Design an…

A: Lamarck's theory The theory says that an organism will pass physical characteristics that were…

Q: What is adaptive radiation? Explain it with the example of Darwin's finches.

A: Introduction  Evolution is the gradual change in the inherited traits of biological populations over…

Q: Draw a labelled diagram of a plant cell before and after insect attack in the case when pre-formed…

A: Plants are unique among eukaryotes, organisms with membrane-enclosed nuclei and organelles, in that…

Q: Formulate a valid, testable hypothesis

A: A hypothesis is a proposed explanation for a phenomenon. For a hypothesis to be a scientific…

Q: Need help with question one

A: The plasmid is the extrachromosomal DNA present in the bacterial cell. These are the extra DNA other…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: What step in the scientific method follows experimentation?

A: Introduction The scientific method of research is a process that involves various steps of…

Q: Describe the efforts to achieve an internationally uniform anatomical terminology;

A: Anatomical terminology is scientific terminology that is used by anatomists, doctors, and…

Q: In general, the ______ variable is purposely changed in an experiment.

A: There are two primary variables in a scientific experiment. The dependent and The independent / (…

Q: What may be expected to happen chromosomally and genetically to: an unfertilized egg that undergoes…

A: *DISCLAIMER FOR MULTIPLE* Since you have asked multiple question, we will solve the first question…

Q: Which of the following characteristics is shared by all types of muscle tissue?   Question 5…

A: Introduction: Movements in the human body are controlled by muscle cells. Involuntary and voluntary…

Q: A medical imaging facility is considering the purchase of a positron emission tomography (PET) or a…

A: Mutual exclusivity can be defined as a phenomenon in which two things taken into consideration…

Q: The nuclear compartment in eukaryotic cells is recognizable even in ordinary light microscope.…

A:

Q: Fourteen NADPH molecules are required to produce one molecules of palmitic acid from acetyl CoA.…

A: Introduction  Fatty acid synthesis is the process by which fatty acids are produced from acetyl-CoA…

Q: Using your fingers, you are asked to aseptically touch the surface of a sterile agar plate.…

A: The aseptic technique of plating on an agar plate means that a sterile or no infection-containing…

Q: 12 13 14 Which of the following is true of a somatic mutation? A. They are mutations passed on to…

A: a DNA change that takes place after fertilisation. Somatic mutations can occur in every cell of the…

Q: Why is it important to have a control for an experiment?

A: An experiment is a procedure that is carried out to support or refute a hypothesis, or to determine…

Q: concise timeline of events that happened in the early history of developmental biology

A: The branch of science that is responsible for the studies into various process that aids in the…

Q: Jenny and Joe are heterozygous for green eyes which is recessive. They have 5 children. What is the…

A: Introduction Recessive traits are those that require two copies of an allele to express themselves…

Q: Match each term with the most suitable description. ___ exocrine gland          a. cell in nervous…

A: Different organs and tissues are there that perform proper functions in the body. This helps in…

Q: Differentiate between the self pollination and cross pollination.

A: Pollination is the sexual reproduction method used by all plants, in which pollen grains are…

Q: How are fractures classified?

A: Fracture is defined as the complete or partial break in a bone.Fractures are caused by direct hit or…

Q: 5 7 In plants, what is the name given to the male gamete joining the female gamete? A. Pollination…

A: The reproduction procedure of plants happens after pollination where the male gamete is introduced…

Q: Describe the three major steps in the Calvin cycle and the role of the key enzyme rubisco.

A: The three crucial phases of the light-independent processes in photosynthesis are referred to as the…

Q: What can be deduced about the center of the circle?

A: The population of a species is controlled by various factors and their control is necessary to…

Q: Chromosomes per cell Chromosomes status DNA (molecules) per cell DNA picograms per cell Ploidy…

A: Chromosome is a structure which is found inside the nucleus of a cell.

Q: What kind of ailment can algal (algae) toxins cause? a. disease caused by a neurotoxin b. anthrax…

A: Introduction  A toxin is an organic poison that occurs in nature and is created by the metabolic…

Q: Instruction: Go outside and observe your surroundings. From your observation, formulate a hypothesis…

A: INTRODUCTION Green plants and other certain autotrophic organisms synthesize their own food material…

Q: Don't copy from Google ASAP

A: We know that The system helps in the breakdown of large and complex food particles into smaller and…

Q: When the skin is exposed to sunlight it will produce: Calcium Vitamin D Vitamin C Vitamin D…

A: Introduction :- An organic substance known as a vitamin is a crucial micronutrient that an organism…

Q: Discuss how assortative mating can influence genotype frequencies. Are there any potential…

A: Introduction Assortative mating sometimes referred to as "non-random mating" is a type of sexual…

Q: Other than bacteria list the other 6 types of Microorganisms listed in your textbook.

A: Microorganisms are defined as the organism that can very smaller in size that they cannot be seen…

Q: Besides agarose gel electrophoresis, there is also SDS-PAGE (sodium dodecyl sulphate- polyacrylamide…

A: To separate DNA, RNA, or protein molecules according to their size and electrical charge, a…

Q: Consider the steps involved in an experiment that uses the scientific method. Arrange the six given…

A: Scientific method is the systematic way of doing experimnet

Q: phase best describes the major process compon evolution? natural selection O adaptation O survival…

A: Ans: Charles Darwin the British naturalist gave the theory of biological evolution. He defined…

Q: Select one: a. glucose.

A: Respiration is an essential chemical activity carried out by all living creatures, including plants,…

Q: The most abundant protein in your body is_______ . a. melanin c. collagen b. elastin d. keratin

A: Introduction  Protein is an important part of our body as our body has multiple tissues formed of…

Q: Give two possible reasons (hypotheses) why pest control specialists experience fewer fatalities from…

A: Pest control specialists have more contact with stinging insects than the general public, but they…

Q: Based on our current knowledge of biology on Earth, above what temperature (in °C) would biological…

A: The survival of the living organisms is dependent on various factors in which temperature is one of…

Q: How can one confirm/investigate the type of inhibition exerted by azt on the hiv reverse…

A: 3'-azido-3'-deoxythymidine (AZT) is a Thymine analogue. It inhibits HIV reverse transcriptase by…

Q: Which of the following is true about the innate immune system? Check all that apply Phagocytosis…

A: Immunity is defined as all of the physiological mechanisms that allow a person's body to recognise…

Q: If you needed blood and the doctor told you, "Hey, you're lucky. You can take any ol' type of…

A: The blood cells of every different individual have a unique set of antigens present in the cell…

Q: Z Primate Opposable Thumb? Length of Thumb (cm) Claws or Nails?

A: A primate is any mammal of the group that includes lemurs, lorises, tarsiers, monkeys, apes, and…

Q: In a 50 square mile section of forest, there are some cut patches of forest where the trees have…

A: A scientific method is a systematic approach to a scientific study. It was developed in the 17th…

Q: Frank and Barbara have type B blood. Their first child has type O blood. They have 3 more children.…

A: Given - blood group of both Frank and Barbara - B Therefore, possible genotypes - IBIB or IBi

Q: A close friend has joined a clinical trial. When you ask her about the types of treatment she might…

A: Introduction :- The purpose of epidemiologists is to use their findings to control diseases or other…

Q: Water is split during the Calvin Cycle of photosynthesis O True False

A: The statement is true

Q: The maximum photosynthetic rate of a sun leaf is higher or lower than a shade leaf? Higher No answer…

A: Photosynthesis is the conversion of light energy by phototrophs into chemical energy, which is then…