Write a Python program that reads from each line of an input file called grades.txt, a student id followed by the student grades in 3 exams. The program will then calculate the average of the student and save in a file called results.txt the student id followed by the calculated average. For example, if the grades.txt contains si11 60 60 90 S222 89.5 90 89 S333 42 50 43 The file results.txt will contain si11: 70.00 S222: 89.50 S333: 45.00

Write a Python program that reads from each line of an input file called grades.txt, a student id followed by the student grades in 3 exams. The program will then calculate the average of the student and save in a file called results.txt the student id followed by the calculated average. For example, if the grades.txt contains si11 60 60 90 S222 89.5 90 89 S333 42 50 43 The file results.txt will contain si11: 70.00 S222: 89.50 S333: 45.00

EBK JAVA PROGRAMMING

9th Edition

ISBN:9781337671385

Author:FARRELL

Publisher:FARRELL

Chapter13: File Input And Output

Section: Chapter Questions

Problem 6PE

See similar textbooks

Similar questions

Write a program that reads student data from a file, compute their GPA and writes the results to a different file. 1. The user should have the option to either enter their text file that contains the student grades or use the provided text file that contains theinformation. The data in "indata.txt" should look similar to this, Lara_Croft75 70 91 69 89Chris_Redfield68 88 79 85 94Johnny_Cochran69 98 95 77 80Wanda_Maximoff84 86 98 95 92Luke_Skywalker74 96 80 98 97William_Kurt89 52 99 81 58Samuel_Jackson50 96 50 64 95END_OF_FILE This is supposed to be in python. This is what I have so far. I have no experience I apologise. I am trying to finish the GPA calculating program currently but am having trouble finishing it. grade = input("enter grades")points = 0 if grade is 90-99:total_points = 4.0if grade is 80-89:total_points = 3.0if grade is 70-79:total_points = 2.0if grade is 60-69:total_points = 1.0if grade is 50-59:total_points = 0.0gpa = total_points/len(grade)print(gpa,"is gpa")
Write a program that reads a file consisting of students' test scores in the range 0-200. It should then determine the number of students has scored in each of the following ranges:0-24, 25-49, 50-74, 75-99, 100-124, 125-149, 150-174, and 175-200. Output the score ranges and the number of students. (Run your program with the following input data: 76, 89,150, 135, 200, 76, 12, 100, 150, 28, 178, 189, 167, 200, 175, 150, 87, 99, 129,149, 176, 200, 87, 35, 157, 189.)
Write a program that reads student information from a text file, then creates a text file that records the course grades of the students and a final grade. Each row of the .txt file contains the Last Name, First Name, Midterm1 score, Midterm2 score, and the Final score of a student, each separated by a space. A sample of the student information is provided in StudentInfo.txt below. Assume the number of students is at least 1 and at most 20. The program performs the following tasks: • Read the file name of the .txt file from the user. • Open the .txt file and read the student information using readline() or readlines(). • Compute the average exam score of each student. • Assign a letter grade to each student based on the average exam score in the following scale: ◦ A: 90 =< x ◦ B: 80 =< x < 90 ◦ C: 70 =< x < 80 ◦ D: 60 =< x < 70 ◦ F: x < 60 • Output the first names, last names, exam scores, and letter…
Write a program that prompts the user for an input file name, reads all words from the input file, and writes the words to the output file named sentences.txt. Start a new line whenever a word ends in a period, question mark, or exclamation mark.
Write a program that reads a student's name followed by five test scores. The program should output the student's name, the five test scores, and the average test score. Output the average test score with two decimal places. The data to be read is stored in a file called test.txt. The output should be stored in a file called testavg.txt. test.txt: A file containing the student names and the five test scores for every student. Andrew Miller 87.50 89 65.75 37 98.50 Green Sheila 91.05 75.88 50.0 65.5 74.30 Sethi Amit 49.82 75 30 74 86.30 testavg.txt: A file containing the student name, the five test scores, and the average of the five test scores for each student.
Write a program that reads a file consisting of students’ test scores in the range 0–200. It should then determine the number of students having scores in each of the following ranges:0–24, 25–49, 50–74, 75–99, 100–124, 125–149, 150–174, and 175–200.Output the score ranges and the number of students. (Run your program with the following input data: 76, 89, 150, 135, 200, 76, 12, 100, 150, 28, 178, 189, 167, 200, 175, 150, 87, 99, 129, 149, 176, 200, 87, 35, 157, 189 #include <iostream> #include <fstream> #include <string> using namespace std; int main() { int scores; int i [8] = { 0 }; ifstream infile("Ch8_Ex4Data.txt"); if ("Ch8_Ex4Data.txt") { while (infile >> scores) { if (scores >= 0 && scores <= 24) i[0]++; if (scores >= 25 && scores <= 49) i[1]++; if (scores >= 50 && scores <= 74) i[2]++; if (scores >= 75 && scores <= 99)…
Write a program that reads a file consisting of students’ test scores in the range 0–200. It should then determine the number of students having scores in each of the following ranges: 0–24, 25–49, 50–74, 75–99, 100–124, 125–149, 150–174, and 175–200. Output the score ranges and the number of students. (Run your program with the following input data: 76, 89, 150, 135, 200, 76, 12, 100, 150, 28, 178, 189, 167, 200, 175, 150, 87, 99, 129, 149, 176, 200, 87, 35, 157, 189 The file its coming from is called Ch8_Ex4Data.txt Programming C++
Write a Python program that reads from the user the name of two files (an input file and an output file). The program will then read each line of the input file and save it in the output file preceded with the line number and removing any of the following punctuations (. , ! ? ; :) found at the end of the line. For example, if the input file is:Mary had a little lamb;Whose fleece was white as snow; And everywhere that Mary went; The lamb was sure to go!Then the output file the content of the input file and saves it in the produced output file will beLine 1: Mary had a little lambLine 2: Whose fleece was white as snow Line 3: And everywhere that MaryLine 4: The lamb was sure to go
Write a program that reads 5 integer numbers from a file"integer.txt",and store sum and average in "result.txt".
Write a program that receives a coded message file(Lab3ExtraCreditCT.txt) from your local espionage agent and decodes it into a file using standard English. The problem is your agent forgot to tell you the key used to decode the message. Fortunately, this is a simple substitution code consistently using 1 alphanumeric character to represent another, this is case sensitive. All other characters are not substituted, so a space will always be a space, a – will always be a –, a @ will always be a @, etcetera. You may use the following table to help you, it contains the most common letters used in the English language in descending order. E A R I O T N S L C U D P M H G B F Y W K V X Z J Q 0 5 3 2 4 6 8 1 9 7 Using the following key to convert plaintext to coded text: Plaintext = Now is the time for all good men to come to the aid of their country. Key = THEQUICKBROWNFXJMPSVLAZYDG The file your program outputs should look like this: Coded Text = Fxz bs vku vbnu ixp tww…
Run a python program that will: a. Read a text file (input.txt) that contains two lines wherein the first line is a normal DNA sequence, while the second line is a mutated DNA sequence. b. The program must also transcribe and translate the sequences by providing outputs for their respective mRNA and protein products. *** input.txt *** ATGGTCAGAACGCGCTGAAATGGTTAGAACGCGCTGAC *** your.py *** Normal RNA Sequence: UACCAGUCUUGCGCGACUUMutated RNA Sequence: UACCAAUCUUGCGCGACUG Normal Protein Sequence: Try Gln Ser Cys Ala ThrMutated Protein Sequence: Try Gln Ser Cys Ala Thr
Write a program that reads in from a file a starting month name, anending month name, and then the monthly rainfall for each monthduring that period. As it does this, it should sum the rainfall amountsand then report the total rainfall and average rainfall for the period.For example, the output might look like this:During the months of March–June, the total rainfall was 7.32 inchesand the average monthly rainfall was 1.83 inches.