Your lab was asked to recommend the best treatment for the patient with a urinary tract infection. Based on the sequencing results, the resistance that was observed against the β-lactam antibiotic amoxicillin likely results from the production of a β-lactamase, an enzyme that degrades β-lactams. However, it is still possible to use β-lactam antibiotics to treat infections caused by bacteria that produce β-lactamases. Some β-lactam antibiotics cannot be degraded very easily by β-lactamases. In addition, β-lactam antibiotics are often co-prescribed with β-lactamase inhibitors, drugs that interfere with β-lactamases and protect β-lactams. Therefore, to identify the best treatment for this bacterial infection, further characterization of the β-lactamase enzyme is needed. A recombinant form of the β-lactamase can be produced in a lab strain of Escherichia coli. This enzyme can then be purified, and its activity and inhibition tested using in vitro enzyme assays. To generate the recombinant β-lactamase, the gene for the β-lactamase must be cloned into an expression vector. This first step in this cloning experiment is to amplify the full gene sequence that encodes this enzyme using the polymerase chain reaction (PCR). Now, design primers to amplify the gene that encodes for the β-lactamase. You should use a Tm calculator (preferably, http://tmcalculator.neb.com/ a free tool; with default settings) when designing these primers, and the Tm values for both primers should be close to 65 °C. The nucleotide sequence of the gene is: > resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG AGCAAGATGCTACATGCTTTCGATTATGGTAATGAGGACATTTCG GGCAATGTAGACAGTTTCTGGCTCGACGGTGGTATTCGAATTTCG GCCACGGAGCAAATCAGCTTTTTAAGAAAGCTGTATCACAATAAG TTACACGTATCGGAGCGCAGCCAGCGTATTGTCAAACAAGCCATG CTGACCGAAGCCAATGGCGACTATATTATTCGGGCTAAAACTGGA TACGATACTAAGATTGGCTGGTGGGTCGGTTGGGTTGAACTTGAT GATAATGTGTGGTTTTTTGCGATGAATATGGATATGCCCACATCG GATGGTTTAGGGCTGCGCCAAGCCATCACAAAAGAAGTGCTCAAA CAGGAAAAAATTATTCCCTAG What are the nucleotide sequences of your forward and reverse primers? Make sure to write out the nucleotide sequences from 5ʹ to 3ʹ, and make sure that your primers amplify the entire sequence shown above, including the start codon and the stop codon.
Your lab was asked to recommend the best treatment for the patient with a urinary tract infection.
Based on the sequencing results, the resistance that was observed against the β-lactam antibiotic amoxicillin likely results from the production of a β-lactamase, an enzyme that degrades β-lactams. However, it is still possible to use β-lactam antibiotics to treat infections caused by bacteria that produce β-lactamases. Some β-lactam antibiotics cannot be degraded very easily by β-lactamases. In addition, β-lactam antibiotics are often co-prescribed with β-lactamase inhibitors, drugs that interfere with β-lactamases and protect β-lactams. Therefore, to identify the best treatment for this bacterial infection, further characterization of the β-lactamase enzyme is needed.
A recombinant form of the β-lactamase can be produced in a lab strain of Escherichia coli. This enzyme can then be purified, and its activity and inhibition tested using in vitro enzyme assays.
To generate the recombinant β-lactamase, the gene for the β-lactamase must be cloned into an expression vector. This first step in this cloning experiment is to amplify the full gene sequence that encodes this enzyme using the polymerase chain reaction (PCR).
Now, design primers to amplify the gene that encodes for the β-lactamase. You should use a Tm calculator (preferably, http://tmcalculator.neb.com/ a free tool; with default settings) when designing these primers, and the Tm values for both primers should be close to 65 °C.
The
> resistance gene
ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT
ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT
TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG
CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA
CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC
AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC
CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG
AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG
CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG
AGCAAGATGCTACATGCTTTCGATTATGGTAATGAGGACATTTCG
GGCAATGTAGACAGTTTCTGGCTCGACGGTGGTATTCGAATTTCG
GCCACGGAGCAAATCAGCTTTTTAAGAAAGCTGTATCACAATAAG
TTACACGTATCGGAGCGCAGCCAGCGTATTGTCAAACAAGCCATG
CTGACCGAAGCCAATGGCGACTATATTATTCGGGCTAAAACTGGA
TACGATACTAAGATTGGCTGGTGGGTCGGTTGGGTTGAACTTGAT
GATAATGTGTGGTTTTTTGCGATGAATATGGATATGCCCACATCG
GATGGTTTAGGGCTGCGCCAAGCCATCACAAAAGAAGTGCTCAAA
CAGGAAAAAATTATTCCCTAG
What are the nucleotide sequences of your forward and reverse primers? Make sure to write out the nucleotide sequences from 5ʹ to 3ʹ, and make sure that your primers amplify the entire sequence shown above, including the start codon and the stop codon.
Step by step
Solved in 3 steps
