Your short answer should be 2-5 sentences depending on the question. (Ch. 54). Please answer both questions. 1) Explain how the competitive exclusion principle can lead to resource partitioning in a community. 2) Explain how dominant species, keystone species, and ecosystem engineers exert strong control on community structure.

Q: For each experimental set up (geotropism and phototropism), identify the  dependent and independent…

A: In an experiment the independent variable is the cause and the dependent variable is the effect. The…

Q: In eukaryotes, fatty acids are stored as triglycerides in cells that have A) Golgi that store fatty…

A: In eukaryote, fatty acids are stored as triglycerides in cells with Golgi that store fatty acids.…

Q: Навчын баганан эсэд байдаг боловч элэгний эсэд байдаггүй эрхтэнцэр аль нь вэ? А. Эсийн мембран…

A: The science of cell's structure and functioning is known as cell biology, and it is based on the…

Q: The Amoeba, the paramecium, and the euglena ( These are unicellular Protozoans) produce electrical…

A: Protozoans are  unicellular eukaryotes belonging to the kingdom protista. The structure of…

Q: Compare and contrast GPCR and RTK signaling. What role does GTP play in each? What role does…

A: Receptors are composed of proteins. These involve in cell signaling process. Two types of receptors…

Q: The frequency of the Z allele in a population of 2000 diploid turtles is 0.2. 250 turtles from a…

A: Allele frequency refers to that how common an allele is present in a population.

Q: Which is not true of Eukaryotic cells? A) A true nucleus contains DNA in the form of chromosomes B)…

A: In our body, there are billions of cells. While no two cells are identical, there are numerous…

Q: I know that Enterobacter Clocoae was supposed to test positive for the catalase test. My test…

A: Enterobacter Clocoae is gram negative bacteria, it is rod shape bacteria that has flagella all over…

Q: mode: Arrange the following events in the correct order of expression during λ phage's lytic (a)…

A: Lambda phage is a virus that infects bacteria. It is one of the most extensively studied viruses and…

Q: Monotremes all have what unifying feature? Arthropod-like pincers Placenta Ventral pouch Ability to…

A: Mammals belonging to the order Monotremata are known as monotremes. The Monotremata are the oldest…

Q: the relationship of knee height and arm span between standing height?

A: Arm span also referred as "wingspan" is described as the physical measurements of length from one…

Q: What do you call this part of a phylogenetic tree pointed by the arrow that indicates divergence or…

A: Introduction:- Phylogenetic tree or evolutionary tree is a two dimensional graph which is used to…

Q: Explain how ALS leads to physiological symptoms

A:

Q: Label the chambers and valves seen in an anterior view of the heart.

A: The correctly labelled diagram is shown in the step 2.

Q: Describe agglutination reaction test used to determine A, B , AB or O blood types. Must explain each…

A: A blood group is classified on the basis of antigens present on the surface of the RBCs. These are…

Q: Which of the following correctly lists mutation types in order from least likely to affect an…

A: A mutation occurs when the order of bases in DNA or RNA changes. Each person has a mutation. In…

Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…

A: Introduction  The process by which a gene's information is used to produce either RNA molecules that…

Q: Drugs and other medecine uses the concept of signaling. Cite some drugs how they mimic natural…

A: Many drugs mimic cell signalling molecules thereby stimulating cell function and compensate for…

Q: describe the IR spectra pattern of ascorbic acid (Vitamin C)

A: Analysing Infra Red (IR) spectra of any compound provide an idea about their identification through…

Q: What is one important advantage of using environmental DNA (eDNA), instead of traditional…

A: The environmental DNA methodology provides a number of benefits over conventional surveying…

Q: Explain the difference between the two ways that alloreactive T cells can be stimulated in an acute…

A: Acute transplant rejection happens days to months following a transplant when the immune system…

Q: #1 #2 Lab 11: Osmosis and Diffusion - - Additional Resources Bio 104 - McCabe 3. Explain how this…

A: When an Elodea cell gets placed in a  solution of lower concentration (hypotonic) than cytoplasm,…

Q: The chromatophore pigment is present in which animal group? Annelida Nematoda Cephalopods O…

A: Chromatophores are the cells which can produce color. Many types of pigment containing cells or…

Q: Explain how Ethnic Origin (regional ancestry) can be determined from bone but not “Race”. Explain…

A: Answer : Ethnic Origin (regional ancestry) can be determined from bone but not “Race” by clearly…

Q: If you are interested in seeing how proteins are folded, you might choose a the proteins wireframe…

A: The amino acid sequence of proteins controls the stable 3-D conformations that they take on.…

Q: The genetic defect responsible for abnormalities in individuals with Turner syndrome is? The…

A: The most prevalent sex chromosomal defect in females is Turner syndrome, commonly known as…

Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice. Q1:…

A: The size of the island and its position is very much crucial for species richness. There are several…

Q: Sahelanthropus tchadensis Facial bones

A: Man is the result of evolution. As a result, human evolution is intrinsically related to the origin…

Q: identify different features of the pelvis gridle by labellig A to J.  Choose from the following…

A: The various features of pelvic girdle as indicated in the diagram are: A. Sacrum B. Sacro-iliac…

Q: A total of 2.5 x 105 cells were harvested from the patient. You need the cells to fill a scaffold…

A: The growth or culturing of cells obtained from different sources such as humans, animals, or plants…

Q: Please explain the difference between complete androgen insensitivity and pe-nis at 12 syndrome.…

A: An uncommon genetic condition of sexual development is known as androgen insensitivity syndrome…

Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…

A: Cancer cells are rapidly growing cells with high energy demand and synthesize more DNA. The high…

Q: During mating season, male rams compete with each other for access to females.  This describes…

A: Introduction:- Sexual selection is the selection of those traits by nature that increases the mating…

Q: If one nondisjunction event occurred during meiosis II, you would expect the four resulting gametes…

A:

Q: The evolution of the highly complex eukaryotic cell was possible because.. A) Mesosomes released…

A: Correct answer is (B). Two different prokaryotic bacterial species entered the complex cells as endo…

Q: Label the structures seen in an anterior view of the heart.

A:

Q: Q2 (a) In 2014, during their iGEM project on biodesalination, students were willing to modify…

A: There are perform a restriction digestion process by restriction endonuclease PstI which recognize…

Q: What enzyme uses phosphocreatine to make ATP? creatine kinase phosphorylation. oxidative What other…

A: What enzyme uses phosphocreatine to make ATP? ans. Creatine kinase What other ways can we make ATP?…

Q: List the three events that occur during the process of photosynthesis. Explain the role of stomata…

A: Introduction  Plants absorb water (H2O) and carbon dioxide (CO2) from the soil and atmosphere during…

Q: 2. What biochemical markers can indicate liver problems? What tests should then be used to identify…

A: Laboratory liver tests help diagnose and treat patients with liver dysfunction. The metabolism of…

Q: The 02 to be utilized by the mitochondria of all eukaryote cells is produced by A) Oxidative…

A: Mitochondria is the cell organelles, found in most of eukaryotes. Mitochondria perform aerobic…

Q: The team would now like to establish the smallest possible deletion that would inactivate the…

A: Amino acid monomers form the building blocks of proteins. The arrangement of amino acids makes up a…

Q: Briefly explain the alternative communication systems in early childhood education or classroom.…

A: Children who have trouble hearing or speaking benefit from alternative communication. Children that…

Q: The phase of the cell cycle in which cells perform thier cellular jobs is A) mitosis B) the G2 phase…

A: The sequence of activities that occur in a cell that leads to the replication of DNA and cell…

Q: 4. Compare and contrast ESCs and iPSCS by considering the following: A) Describe the method of…

A: Over the last few years, biomedical engineering has grown in popularity. Biomedical engineers' new…

Q: 3. Explain the mechanism of liver injury during hepatitis. What role does the immune system play?

A: Hepatitis B (HBV) and C (HCV) viruses are among the seven human hepatitis viruses (A to E, G, and TT…

Q: http://www.treeboss.net/tree-trunk-splotches.htm downloaded 21 March 2012 Q12. What do you think it…

A: This activity is about different types of living beings which have different characteristics such as…

Q: Match the below with the correct descriptions Proteins that hold together two sister chromatids…

A: INTRODUCTION Answers to the match the following is given below.

Q: In a homeostatically regulated system, diagram or identify the regulated homeostatic variable,…

A: External substances that disrupt the generation, secretion, distribution, metabolic activity,…

Q: please solve these both sub-parts accurate and exact. Thank you! (a) Describe at least three…

A:

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.