3. Results
3.1. Identification and characterization of three GS isoforms
Three different GS sequences (GS01, GS02 and GS03) have been identified through the sequencing and blastx searching. All the sequences contain a complete coding sequence (CDS) region and 5′ and 3′-UTRs. In this study we have attempted the characterization of the multiple GS cDNAs present. The characteristics details of the full-length cDNAs of GS01 (Accession No. JQ740737), GS02 (Accession No. JQ740738) and GS03 (Accession No. JX457351) are given in Table 2.
Analysis with the UTRscan tool revealed the presence of one Musashi Binding Element (MBE) in both GS01 and GS02 transcripts. But there was no MBE present in GS03 UTR. Conserved Domain Database search (CD-search)
…show more content…
NetPhos 2.0 analysis projected 9/11/11 serine, 2/3/2 threonine and 5/7/7 tyrosine phosphorylation sites for GS01/GS02/GS03 proteins respectively. The homology modelling of the enzyme shows 12 identical subunits, arranged in two layers of 6. The secondary structure of GS consisted of 7 alpha helix and 15 beta strands. The binding residues, predicted by the RaptorX binding web server, and the corresponding ligands for the three different GS proteins are given in Table 3.
3.3. Phylogenetic analysis
The alignment of the multiple GS amino acid sequences with fishes, amphibians and mammalian proteins is presented in Fig. . The homologous active site residues for GS in C. batrachus were determined using the Salmonella typhimurium GS X-ray crystallography structure (Gill and Eisenberg, 2001). The pairwise alignment shows presence of 15 of the 16 residues identified in Salmonella. The residues are completely conserved among fishes, amphibians and mammals (Fig.). With respect to the Salmonella, only three of 15 residues present in catfish are substituted (positions 194, 196 and 246). The phylogenetic tree clearly revealed
3.4. Differential expression of GS mRNA transcripts in NH4Cl-treated fish
There were significant increases of expression of different GS mRNA (GS01, GS02 and GS03) transcripts in different tissues (liver, kidney, brain and muscle) following the 50 mM NH4Cl treatment. In the brain, where
Comparing the BLASTx and BLASTp search results, allowed me to determine if I chose the correct ORF in the Toolbox which I believe I did as the proteins found in the BLASTp search were the same as the proteins found in the BLASTx search. The E-values for the same protein found by both the BLASTx and BLASTp searches were also the same but only the start and stop positions of the BLASTx and BLASTp alignments were different for the same protein. Overall, I determined the 5’ UTR to be G1-A28 and the ORF to be A29-G1051.
There were several steps used to acquire the colony necessary for the PCR. First a student forearm was swabbed using a cotton swab, the cells were then placed in an agar plate. DNA was then extracted from the cultured bacteria by using a technique to lyse the cells and solubilize the DNA, then enzymes were used to remove contaminating proteins. The DNA extraction consisted of a lysis buffer that contained high concentrations of salt for denaturing. Binding with the use of ethanol and a washing step to purify the DNA. The final step for the DNA extraction was elution where the pure DNA was release. Proceeding the extraction of DNA the results of the 16s gene amplification were examined through gel electrophoresis it was analyzed by estimating the size of the PCR bands with marker bands. After measuring the success of the extraction, a technique called TA cloning was started. Cloning of PCR products was done by using partially purified amplified products with
Second, in order to further confirm the information about characteristics and function of the targeting protein that we have
The predicted antigenic regions were chimerically expressed in a bacterial system. Briefly, two sets of PCR primers were designed according to gD gene sequence available in GenBank (accession number: NC_001847) to amplify gene fragments encoding aa 20-160 (nucleotide 118953~119375, Δ gD1) and aa 257-344 (nucleotide 119664~119927, Δ gD2), respectively. The primers sequences for amplification of Δ gD1(P1 and P2) and Δ gD2 (P3 and P4) were listed in Table. 1.
SDS-PAGE Electrophoresis Gel. - Expression of numerous proteins in different fractions of yeast lysate. Marker proteins were utilised in order to identify them under reducing conditions. Polyacrylamide gel was stained with Instant Blue Coomasie Stain which binds itself to proteins allowing band patterns to be viewed. 10ul of molecular weight standards was expelled in the first lane with the remaining fractions in the following lanes. GAPDH rabbit muscle and Yeast ADH was used as a control.
Glycoprotein 130 (GP130) is a transmembrane protein which is a type of cytokine receptor that possesses a WSXWS amino acid, whose function is to ensure correct protein folding and ligand binding. It interacts with the Janus Kinase (JAK), a noneceptor tyrosine kinase that transduces cytokine mediated signals through the JAK-STAT pathway. GP130 is able interact with JAK by phosphorylating on a tyrosine, which is a type of amino acid that is able to be used by cells to synthesize proteins. This process occurs in the JAK, when the GP130 signals binds to the JAK paired receptors, and once it binds to the paired receptors. Protein kinases regions turn on and become active and begin to auto phosphorylate. Autophosphorylation is due to the paired tyrosine
Fetal rat cerebral cortical neurons were treated with E (4 mg/ml) for 24 h and pregnant dams were treated with the “Binge” model as detailed above. Both of these regimens elevate Nrf2 expression as well as induce enhanced apoptotic death of neurons [5, 7]. To gain a better understanding of the E-induced GSH loss, we first assessed the levels of cysteine, which is one of the key substrates involved in de novo synthesis of GSH. Illustrated in figure 3, both in vivo maternal exposures and the in vitro PCNs treatment with E reduced Cys with a concomitant decrease in the GSH content. Cys was decreased in PCNs and fetal
For the second part of the experiment, one had to use the knowledge learn from viewing protein molecules in FirstGlance in Jmol to analyze the protein PDB ID: 4EEY. The analysis of this protein was done using the RSCB protein data bank (PDB) at (http://www.rcsb.org/pdb/home/home.do).2
In a normally functioning cell, the gene SerB codes for an enzyme which plays a role in the last step of serine production. Serine is an essential amino acid which is required for the cell to survive. The researchers in Hecht lab at Princeton University discovered that a synthetic protein SynSerB substitutes the SerB gene which is lacking in some of the cells.
The cytoplasmic enzyme/ catalytic domain may be: › Tyrosine kinase › Serine Kinase › Guanylyl cyclase
Polyphen2.0 (Polymorphism Phenotyping) a multi-sequence alignment server predicts the functional impact of an amino acid substitution. The prediction is a straightforward empirical rule which is automatically applied to the structural, sequence, and phylogenetic information, and readily characterizes the amino acid substitution (Ramensky et al. 2002). To determine the effect of variants on the protein secondary structure, inter chain contents, functional sites, and binding sites, Polyphen2.0 utilizes PDB (Protein Data Bank), DSSP (Dictionary of secondary structures in protein), and three-dimensional structure databases (Ramensky et al. 2002). We submitted the query in the form of the protein sequence with the mutational position of two amino
It is also known that the HMGR is a very flexible enzyme when in its three dimensional structure and
Total RNA was extracted from frozen kidney tissues after processing using Qiagen RNeasy Total RNA isolation kit (Qiagen, Hiden, Germany) according to the protocol provided by the manufacturer, followed by synthesis of the first strand using SuperScript ® III First-Strand Synthesis System for RT-PCR kit (Life Technologies) according to the manufacturer’s instructions. PCR reactions were performed using Power SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. Smad3 mRNA transcripts were quantified, relative to the housekeeping gene, glyceraldehyde-3-phosphatedehydrogenase (GAPDH) which was used as an internal control. Sequence specific primers were designed by Primer3 software: (http://bioinfo.ut.ee/primer3/) as follows: rat Smad3 forward primer (5 '- AGGGCTTTGAGGCTGTCTACC-3 ') and reverse primer (5 '- ACCCGATCCCTTTACTCCCA -3 ') (GenBank Accession No. NM_016769.4); rat GAPDH forward primer (5′-GGTGAAGTTCGGAGTCAACGGA-3′) and reverse primer (5′-GAGGGATCTCGCTCCTGGAAGA-3′) (GenBank Accession No. NM_017008). The final results were automatically calculated from the cross-point values of the target and the reference gene by Rotor-Gene Q 6plex and its specific software (Qiagen, Valencia, CA, USA).
The products were run through the 1.0% Agarose gel with bromophenol blue and the bands were visualized under UV transluminator. Amplification by polymerase chain reaction method was done using one pair of 16S rRNA and one pair of COI primer sets. Among them for 16S rRNA gene E. kalasgramensis, H. tytleri and F. nepalensis were successfully amplified, for COI gene only E. kalagramensis was successfully amplified. Amplified products were sequenced and the product length was 553bp, 523bp and 521bp base pair long for 16S rRNA gene for E. kalasgramensis, H. tytleri and F. nepalensis, respectively and 612 bp long COI gene of E. kalasgramensis. The sequences were transferred to FASTA format and BLASTED within nucleotide database for the authentication and matched in a range of 98%-100% for consensus sequence of the three species. GenBank based identification yielded an alignment E-value of 0.0. The overall amplification and sequencing success of the CO1 primers was low compared to the 16S gene. After several attempt COI gene was successful to amplify only for one species.