1. Using the data available describe the phenotype that you observe when each of these three genes is knocked down using RNAi. Remember to compare the worms on control RNAi plates with worms on each of the RNAi knockdown plates. In each case state how do these phenotypes relate to the function of the gene. （gene name for F27C1.8 is dpy-5，for T19E7.2 is skn-1） 2. Describe further experiments that you could do that would confirm your findings.

1. Using the data available describe the phenotype that you observe when each of these three genes is knocked down using RNAi. Remember to compare the worms on control RNAi plates with worms on each of the RNAi knockdown plates. In each case state how do these phenotypes relate to the function of the gene. （gene name for F27C1.8 is dpy-5，for T19E7.2 is skn-1） 2. Describe further experiments that you could do that would confirm your findings.

Name: 1. Using the data available describe the phenotype that you observe wh
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 1. Using the data available describe the phenotype that you observe when each of these three genes is knocked down using RNAi. Remember to compare the worms on control RNAi plates with worms on each of the RNAi knockdown plates. In each case state ho

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter23: Protists

Section: Chapter Questions

Problem 8RQ: In 2016, scientists published the genome of Monoceiconionoides, and demonstrated that this organism...

See similar textbooks

Similar questions

Modified true or false. Encode the word true if the statement is correct. If the underline word/s is incorrect, then correct the underlined word/s that makes the statement wrong by encoding the correct answer beside false. Answers must be encoded in capital letters 1. When Grammia incorrupta caterpillars are infected by a parasitoid, they show an increased preference for acidic toxins found in larval food plants, and by choosing to eat these toxic plants when infected, are able to increase survival.
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…
Short answers questions 1. Give 4 examples of transcription factors / non-structural proteins ? 2. Identify the most commonly used technique for diagnosing COVID-19? And the clinical sample for each technique. 3. …….…… virus can cause encephalitis, cancer, sexually transmitted disease, infect external genitalia, mucosal surfaces, gladiatorum, and/or other diseases. How can the infection with this virus be avoided? Suggest two ways of prevention or to destroy the virus. 4. How can a defect in p53 gene contribute to cancer development? 5. A patient 19 year-old came to hospital and she had sore throat, fever, red tonsils and swollen uvula, and neck lymphadenopathy. She was given initially antibiotics and came after 5 days with tired, 39ºC. She had patches of white exudate on the tonsils, lymphadenopathy and splenomegaly. Hematological examination shows atypical lymphocytosis. A. Why do you think did she have these symptoms? Answer: these symptoms are for ……………………….…
In 2016, scientists published the genome of Monoceiconionoides, and demonstrated that this organism has no detectable mitochondrial genes. However, its genome was arranged in linear chromosomes wrapped around histones which are contained within the nucleus. Monoceiconionoides is therefore a(n). Bacteria Archea Eukaryote Endosymbiont
Prions are responsible for variant Creutzfeldt Jakob Disease, which has resulted in over 100 human deaths in Great Britain during the last 10 years. How do humans contract this disease?
52. Papaya plants are very susceptible to the papaya ringspot virus (PRSV), which stunts the growth of the fruit and negatively impacts the taste. By 1995, PRSV wiped out the Hawaiian papaya crop completely and made it impossible to produce papaya commercially. In 1998, Cornell University developed a genetically modified papaya called Rainbow that was resistant to PRSV and introduced it to Hawaii. Currently, 80% of the papaya cultivated in Hawaii is genetically modified to be resistant to PRSV.Which of the following rows identifies the effect of PRSV on the original papaya population and the reason why the population recovered? Select one: a. Effect on the Original Population Reason for Recovery Population bottleneck Some papaya had the PRSV-resistance gene. b. Effect on the Original Population Reason for Recovery Increased gene flow The PRSV-resistance gene had to be artificially introduced to the papaya genome c. Effect on the Original Population Reason…
TWO PART QUESTION PLEASE ANSWER BOTH THANKS The data below is the measured levels of percent inactive toxins for the wild-type e coli growth. A. Create a graph for the expected results of % mRNA cleavage with the same conditions, explain reasoning, label title and axis B. The original experiment is repeated 3x. Each time it’s repeated, you added a single chemical that is different, A, B, and C. The data below (image labeled “for question part B” on the top left) is the data collection for each round of experiments. For each Chemical “__” graph, answer the question: Is the chemical added a neutral factor, a stress, or a nutrient for the wild type e coli, and give clear rationale explanation.