Biochemistry - 6th Edition - by Reginald H. Garrett, Charles M. Grisham - ISBN 9781305577206
Buy this textbookBuy

Biochemistry
6th Edition
Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
ISBN: 9781305577206

Solutions for Biochemistry

View Samples

Book Details

Succeed in the course with BIOCHEMISTRY. The authors' innovative conceptual and organizing "Essential Questions" framework guides you through course concepts in a way that reveals the beauty and usefulness of biochemistry in the everyday world. Offering a balanced and streamlined presentation, this edition has been updated throughout with new material and revised presentations. This book is integrated with OWLv2, a powerful online learning system for chemistry with book-specific end-of-chapter material that will help you improve your grades and master course concepts.

Sample Solutions for this Textbook

We offer sample solutions for Biochemistry homework problems. See examples below:
In the polar backbone of DNA and RNA, the phosphate groups are completely ionizable and negatively...In gel electrophoresis, using dyes such as radioactive labels or fluorescent tags makes it possible...The digestion with EcoRI generates both the DNA fragment and the plasmid. This simply means that...For enzyme kinetics, Leonor Michaelis, a German biochemist had made a very best-understood and known...Chymotrypsin undergoes covalent inactivation reaction by nucleophilic attack on the CH2 carbon of...Enzyme activity is controlled through various mechanisms in the cell. They are listed as: With the...The pronghorn antelope animal should have a highly vascularized muscle structure to provide enough...A human is made of 18% of carbon. 18100×70 kg=12.6 kg Therefore, a 70 kg man has 12.6 kg of carbon....The first step of Glycolysis is energy-consuming in nature. The following reactions of glycolysis...During Mitochondrial Pyruvate Transport, Glutamate maintains the TCA cycle and survival of the cell....Two half-reactions for the given equation are given as: FAD+2H++2e−→FADH2(E0'=0.02V)cytochrome...The equation of quantum light energy is given as, E=Nhcλ We have,...The main reactions are as follows: 2 Pyruvate + 4 ATP + 2 GTP + 2 NADH + 2 H+ + 6 H2O→ glucose + 4...If the all the triglycerides are formed by palmitic acid, the palmitic acid percentage in...In the synthesis of malonyl CoA, the carbons in acetyl group of acetyl CoA is derived from glucose...The most stable oxidation state of oxygen is zero. The formula of the nitrate is NO3− The oxidation...Purine is represented in a double-ring structure which has four-nitrogen and five-carbon atoms. In...The equilibrium constant can be calculated as follows: △G°=-RT In K eq Keq=e −△G° RT = e...The density of DNA after one generation is calculated with arithmetic mean of densities...The 3’ end of messenger ribonucleic acid can complement the 5’ end of the deoxyribonucleic acid...Given: Partial amino acid sequence of the protein: …CAATACGAAGCAATCCCGCGACTAGACCTTAAC… To create any...Elongation of the amino acid needs 4 ATP per amino acid. The initial step in elongating the...The main functions of steroid hormones are to regulate the metabolism, the inflammatory processes,...

More Editions of This Book

Corresponding editions of this textbook are also available below:
BIOCHEMISTRY II >CUSTOM<
17 Edition
ISBN: 9781337449014
BIOCHEM. II-EBOOK ACCESS>CUSTOM<
18 Edition
ISBN: 9781337700320
Study Guide With Student Solutions Manual And Problems Book For Garrett/grisham's Biochemistry, 6th
6 Edition
ISBN: 9781305882409
Owlv2 With Student Solutions Manual, 4 Terms (24 Months) Printed Access Card For Garrett/grisham's Biochemistry Technology Update, 6th
6 Edition
ISBN: 9781305882126
Biochemistry
4 Edition
ISBN: 9780495109358
Biochemistry
5 Edition
ISBN: 9781133106296