1. What is the nature of spore-bearing hyphae of the following: (tell whether it is enlarged tip, branched tip, or branched conidiphore) - Aspergillus sp. - Trichoderma sp. - Fusarium sp.

Q: Why are fish gills the most efficient of all respiratory organs?

A: Introduction  The respiratory system, also known as the respiratory apparatus or ventilatory system,…

Q: Hello, please read the attached Microbiology question and answer correctly.  *If you correctly…

A: Bacterial species which are responsible for causing pneumonia are Streptococcus pneumoniae and…

Q: Question 4: Does production of high density of leaf hairs affect the response to competition?…

A: A hypothesis in research study refers to a question or idea which needs to be tested experimentally…

Q: Q4. You conducted an experiment similar to Morgan's fruit fly but you used honey bee instead. You…

A: Linkage is a phenomenon in which genes are exhibited on the same chromosome instead of another .…

Q: Identify the following features of the mandible: 1) 2) 3) 4) 5) What does "postcranial" mean? What…

A: Introduction The system that makes the internal framework of the human body is termed the…

Q: List and explain the mechanisms of evolution and provide examples (and data) that illustrate each

A: Introduction:-  Evolution is the change in the characteristics of species over several generations…

Q: Under stressful conditions epinephrine is released from the adrenal medulla. The release of…

A: Introduction :- Epinephrine, sometimes referred to as adrenaline, is a hormone and medicine that…

Q: The following is passive transport of a solute: O a Diffusion O b. Osmosis Oc. Endocytosis Od. A and…

A: The membrane of the cell is semi-permeable. It permits the passage of certain molecules over the…

Q: You are visiting the Dzantik'l Heeni nature reserve, outside Junea, Alaska. Use the illustration…

A: Introduction Species richness: Species richness refers to the total number of species present in an…

Q: What specific reaction cannot occur due to the presence of cyanide? A.Transfer of electrons to…

A: Correct answer is option C Cyanide is suppose to be the poison as it interrupt the electron…

Q: what rate in drops per minute should the flow rate be adjusted in order to administer the infusion…

A: Given 15 ml of 10% calcium gluconate and  10 ml of a multivitamin infusion are mixed with 500 ml of…

Q: Describe the types of mutation discussed in class and the consequences these havefor the evolution…

A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…

Q: List examples that illustrate how the structure of a body part makes possible its function

A:

Q: How can a B cell have both IgM and IgD on its surface?

A: * B cells produce from lymphoid progenitor cell which develop in fetal liver and later in bone…

Q: A transformation experiment is carried out using donor DNA that is A B C and a recipient that is…

A:

Q: The graph below shows the species richness of a community undergoing secondary succession. The…

A: Secondary succession is a succession which occurs in a place where an already developed community…

Q: How can telomerase-related aging be addressed therapeutically?

A: Introduction DNA is packed inside the cell in the form of chromosomes and chromatin. The…

Q: 1) Using the equations for cellular respiration and photosynthesis, explain what makes one pathway…

A: We are allowed to do upto three subpart of a question. Please repost the undone questions again.…

Q: There is a type of toxin found in the liver of the puffer fish that prevents the opening of…

A: Introduction  The neurotoxin tetrodotoxin (TTX) is highly toxic. Its name is derived from the group…

Q: What are the key anatomical and physiological changes that occur in the renal system of an infant at…

A: Renal system It refers to the organ system that produces urine in the kidneys and transports it to…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: You compare two strands of mtDNA and discover that there are 3 differences in base pairs between…

A:

Q: 11. A phage cross is made by doubly infecting the host bacterial cell with parental phages: m¹g¯ X…

A: The parental genotypes are produced without crossing over. The recombinant genotypes are produced as…

Q: Short Essay. In 5 sentences, explain how eugenics can be considered a by using at least TWO (2)…

A: Introduction  Eugenics is the practise of selectively breeding members of the human population to…

Q: Why is sensory adaptation advantageous?

A: Note: As per guidelines,we can answer one question at a time. Ask rest !!Introduction  In order to…

Q: The following describes the decrease concentration of particles in water: O a Hypertonic Fluid Ob.…

A: Introduction :  Osmosis is defined as the movement of solvent molecules through a selectively…

Q: What type of cell is this and where are the genes located inside of this cell?

A: Cells are basic structural and functional units of life.There are two major types of cells -…

Q: Activation of certain GPCRs triggers an intracellular signaling mechanism that involves activation…

A: The most numerous and varied class of membrane receptors found in eukaryotes are G-protein-coupled…

Q: explain what your next steps are if your Free Water  test exceeds the allotted PPM

A: High TDS level in water not only deteriorate it's taste but also it's odour. If such water is…

Q: A population consists of 300 individuals with the following genotypes: AA – 100…

A: Hardy-Weinberg equilibrium is a principle stating that the genetic variation in a population will…

Q: 10 miracles of breathing

A: Breathing is a process of two major phases which are inhalation and exhalation. During inhalation…

Q: Aside from the application of heat, name other methods of sterilization and give examples of…

A: Introduction  Sterilization is a process of killing all microorganisms (bacteria, viruses,…

Q: Describe the process of chemical digestion of our three major macronutrients, carbohydrates,…

A: Chemical digestion is the breakdown of food with the help of enzymes. Enzymes are released by…

Q: The end products of glycolysis are O A. pyruvate. SO B. pyruvate, ATP, and NAD+. OC. acetyl CoA,…

A: Cellular respiration is a process that involves The breakdown of complex organic molecules with the…

Q: Voltage-gated Na+ channels are.... (select all that apply).  Group of answer choices: A. Opened by…

A: The channels are basically membrane proteins that act as transport protein through which various…

Q: As a consumer, how will you react emotionally to having clean and safe water produced from biomass…

A: Biomass is an organic substance which includes plant, animal and municipal wastes used to produce…

Q: The pangolin or scaly anteater’s body is covered with scales. How come it is classified as a mammal?…

A: Introduction: Any member of the group of vertebrate animals in which the young are fed with milk…

Q: List five proteins of the myofilaments and describe their physical arrangement.

A: The myofilaments are the proteins that make up the contractile elements of muscle cells. There are…

Q: Which level of disturbance promotes the greatest community diversity? O Very low disturbance A…

A: A community is defined as a group of different species inhabiting the same geographical area.…

Q: (A) Which of the above offspring are recombinant? (B) What is the map distance between the genes?

A: ANSWER1. Recombinants: These are those offspring that have traits different from their parents.…

Q: In radish the effect of the alleles producing the red long variety is incompletely dominant over the…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: 8. You have sequenced a segment of DNA from a species in the genus Lithobates (true frogs). The…

A: The regulation of gene expression in a cell to prevent the expression of a specific gene is known as…

Q: Enumerate the Good Microbiological Practices encountered in the activity.

A: Microbiological practices are those precautions which  we have  follow while working in the…

Q: Enzymes are biological catalysts that fulfill the following general reaction mechanism: E+S [ES]…

A: Enzymes are the basically proteinaceous substances whose main role is to accerate rate of chemical…

Q: elF4E binds to Select an answer and submit. For keyboard navigation, use the up/down arrow keys to…

A: Translation The process of making new polypeptide chain from mRNA.

Q: These data were collected experiments on laboratory populations. Experiments such as these where we…

A: Introduction The search for truth is the basis of every research and experiment. It is studied under…

Q: If an non disjunction occurs in meiosis 2 in a male and the resulting sperm fertilizes a normal…

A: Introduction  When a mother cell divides into two or more daughter cells, this process is known as…

Q: Glucose Oxidase – Triglyceride – Total cholesterol - HIgh density lipid – 5. What are some…

A: 1. Glucose oxidase test- used for the determination of free glucose in body fluids. 2. Triglycerides…

Q: Given the following, the sequence of urine flow in the urinary tract is: i. Renal papilla ii. Major…

A: We know that Urine is formed by filtering the blood in the kidney in the body. Metabolic wastes such…

Q: What can be done at home to reduce the amount of bacteria on food?

A: Bacteria These are single-celled prokaryotic organisms that are present almost everywhere. Some…

Fungi

Fungi can be single-celled or complex multicellular creatures. They are found in pretty much any natural surroundings; however, they generally live on the land, principally in soil or plant material instead of in the ocean or water. Fungi are the members of the group called the decomposers that live off dead and decaying matters. Fungi assume a significant part in the carbon cycle and its different components. They act as a parasite by causing illnesses like rusts, scabs, or ulcers. In crops, contagious illnesses can prompt critical money-related misfortune for the rancher. An exceptionally modest number of growths cause illnesses in creatures. In people, these incorporate skin illnesses such as competitors' feet, ringworm, and thrush.