1. What is xenotransplantation?

Q: In microscopy, what could be the possible reason why we cannot completely resolve the specimen under…

A: A microscope is a lab instrument used to examine the objects that are too small to be seen by the…

Q: Explain why is it important for people to know about converting waste to value-added products. What…

A: Environment and animal life is directly proportional to each other. If environment is affected then…

Q: Organisms growing anaerobically cannot perform glycolysis for long without reducing the pyruvate…

A:

Q: The "yoked control" experiments performed during operant conditioning of the aerial respiratory…

A: * A yoked control design in which matched research subjects are yoked by receiving the same stimuli…

Q: All herbivore species are small such as insects and would not be able to have massive muscular…

A: * Herbivores are organisms that feeds on plants and they can range in size from tiny insects like…

Q: iscuss the intestinal phase of gastric secretion regulation with examples

A: The digestive system is involved in a variety of processes, including food digestion and nutrient…

Q: Diagram a translocation arising from repetitive DNA.Repeat for a deletion.

A: Changes in the structure of chromosomes may create issues with the body's systems' development,…

Q: explain the difference between the lytic and lysogenic cycle.

A: Many bacteria appear to have embraced lysogeny as a means of surviving and surviving in the…

Q: What aminos acid would the anticodon GAC be translated into?

A: * DNA will have four nucleotides  Adenine Guanine Cytosine Thymine * RNA will have four…

Q: A cell that proceeded to cell division without completing S phase would:

A: The first stage of the cell division is Interphase. Interphase is further divided into 3 stages -…

Q: 1. Substances move through biological membranes against concentration gradients via: a. Simple…

A: In active transport, the cell need to use energy in the form of ATP to transfer molecules across a…

Q: Discuss the environmental consequences of biomaterials compared to non-biomaterials.

A: A biomaterial is a substance that has been developed to interact with biological systems for…

Q: How Enteropathogenic E. coli influences carcinogenesis

A:

Q: 19 A Review Which of the following animals has shorter small intestine? Only One Correct Answer A.…

A: Tiger: The tiger (Panthera tigris) is the world's largest living cat and belongs to the Panthera…

Q: This figure can be used to represent the sequence of events leading to the evolution of dark-furred…

A: Evolution is the change in the characteristics of a species over several generations and relies on…

Q: The vertebrae in the upper three regions of the column remain distinct throughout life and are known…

A: The vertebral column is a flexible column with series of bones called vertebrae. There are 33…

Q: A person of type A blood receives blood after a collision between a car and a bus. Shortly after,…

A: Blood transfusion is a process of transferring the same type of blood from the donor to the…

Q: false: in humans, genes make up more than 50% of the genome.

A: Most genomes, including the human genome and those of all other cellular life forms, are made of DNA

Q: For genotype: repP lach lacPt lacO+ lacZt lacY Select the best description of beta-galactosidase…

A: Beta galactosidase is an enzyme which breaks the disaccharide lactose to produce galactos and…

Q: An example of a limiting factor would be the amount of food available in a population. True False

A: Introduction :- A limiting factor is something that restricts the size of a population and slows or…

Q: Question 44 The term RNA refers to RNA. Blank 1 Blank 1 Add your answer

A: INTRODUCTION Answer to the question 44 is given below.

Q: Construct a comparative matrix on different sterilization methods.

A: In our enterprise groups, it’s vital to have an expansion of sterilization methods so that you can…

Q: Answer questions in the table below about the shape of the hydrogen cyanide (HCN) molecule. How many…

A: The structure of the HCN is linear as the central atom is carbon .

Q: A.Binomial Theorem : Marco, heterozygous for able to his roll (Tt), marries Mary v heterozygous for…

A: Homozygous or heterozygous dominant traits are expressed where as recessive traits are always…

Q: Compare and contrast the different transport mechanisms: Electrochemical gradient…

A: Factor Passive Diffusion Facilitated Diffusion Active Transport Electrochemical Gradient Present…

Q: Question 36 Most eukaryotic RNA consists of coding regions, called and noncoding regions, called A…

A: INTRODUCTION Answer to the question 36 is given below.

Q: A mutation produces a new beneficial dominant allele.  Which of the following statements is false…

A: Mutation   Any changes in the DNA from its originality is known as mutation.

Q: 8. Explain the steps that lead to phosphorylation (activation) of Akt by EGFR receptor.

A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Q: Anaerobic respiration in humans occurs primarily in muscle cells during high- intensity exercise.…

A: Primary source of fuel in muscles is glucose, for both aerobic and anaerobic metabolism. In aerobic…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: What similarities and what differences between the graphs? What antibiotics were the most…

A: These graphs are based on the observation of bacteria collected from cave and were tested for…

Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…

A: DNA is the protein in all living organisms that convey genetic information.

Q: The elements that present in Protoplasm

A: A cell's protoplasm, cytoplasm, and nucleus are all examples of protoplasm. The phrase was first…

Q: The molecular weight of a particular polymer should fall between 750 and 1,035. Thirty samples of…

A: The quality characteristic has a normal distribution with specification limits USL = 1035 and…

Q: Natural selection favored dark-colored fur in the rock pocket mouse.  The selective force on the…

A: Natural selection  It is a natural biological process where organisms adapt and change there…

Q: What are the divisions of the nervous system? 2. Differentiate the functions of the endocrine and…

A: Smallest function unit of nervous system is neuron. Various neurons are connected to each other and…

Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…

A: Bone is a mineralized connective tissue . The matrix of bone is made up of calcium and phosphate…

Q: The subunit in E. coli RNA polymerase which is required for recognition of the promoter sequence is…

A: Transcription is a process by which an RNA copy of the DNA is made. It is an important step in gene…

Q: Which option would not disturb a Hardy-Weinberg Equilibrium in a population? a) Random mating b)…

A: Hardy-Weinberg Equilibrium is the theory of population which states that the genetic variation in a…

Q: A cell experiences a mutation where the DNA polymerase III enzyme can now add nucleotides to either…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: Please Give a clear explanation handwritten answer.

A:

Q: The International Union for the Conservation of Nature and Natural Resources (IUCN), has declared…

A: Some of the conservation strategies adopted by wildlife conservation in the Philippines are the…

Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT:

A: A promoter is a region of DNA where RNA polymerase begins to transcribe a gene.

Q: escribe extensions of Mendelian Analysis

A: In an over view, Mendel's laws have been extended to include Multiple Alleles Incomplete Dominance…

Q: Cite 4 important Glycobiology applications or studies

A: Glycobiology is the branch of Biology that deals with the study of the structure, function,…

Q: Which statement is false when considering alleles and gene

A: An allele is a part of the gene. Generally, two alleles make one gene. Based on the presence of the…

Q: QUESTION 9 mc The line of evidence used to support the concept of evolution that deals with looking…

A: Evolutionary developmental biology is considered a new norm in evolutionary biology. It arose from…

Q: Name the food value mainly got by feeding on root tubers

A: Roots and tuber crops are major agricultural staple energy sources in tropical portions of the…

Q: Which of the stated relationships is correct? A. the heart is inferior to the clavicle B. the…

A: Introduction Proximal means close to or near the trunk or the origin of a part (example, the…

Q: Which of the following is/are the contents of the ventral cavity? A. heart and lungs B. brain and…

A: Introduction - The anterior (front) part of the human body has a cavity called the ventral body…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.