For genotype: repP lach lacPt lacO+ lacZt lacY Select the best description of beta-galactosidase activity in the following environmental conditions.
Q: SSBS are: A single-stranded bodies called Okazaki fragments. B substrates for DNA ligases. ©…
A: The biological information flows through genes. DNA is the main genetic material of most of living…
Q: Rowena was tasked to measure the actual magnification of her specimen mounted on a slide without…
A: A microscope is a piece of scientific equipment which magnifies very small objects that are too…
Q: Which of the following helps Human sperm with locomotion? a) Flagellum ) Rasal hody.
A: Sperm cells are small, mobile cells produced in large quantities by the male reproductive system.…
Q: 1111 ) cY TO PLASMIC FRACION (UNTREATED CELS) 2. ) CYTOPLASWMIC FRA CIION ( LPS TREATEO) 4) NuCLEAie…
A: Lane 1 consist of know molecular weight to which comparision can be done with those of other lanes…
Q: Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three…
A: The most common causes of anemia in the elderly are chronic disease and iron deficiency. Vitamin B12…
Q: what is the relationship between genes and traits expressed in individuals? a) gene code for DNA,…
A: Every living organisms contain DNA as the genetic material. In case of eukaryotic cells the DNA is…
Q: true or false: a cell spends most of its life in G1 of interphase building proteins and making ATP.…
A: Introduction Cell is the smallest basic unit of life that can live on its own, is responsible for…
Q: Are plants male female or both? EXPLAIN Please answer asap and your content should not be palgarised
A: The term "plant" refers to a diverse group of living organisms that all belong to the Plantae…
Q: If you had a mixture of single-stranded DNA fragments, all 4 deoxyribonucleoside triphosphates, and…
A: DNA replication is the process of producing complementary DNA molecules from the ds DNA molecule.
Q: Illustration of stages in Meiosis 1 with 10 chromosomes, explain briefly
A: Meiosis is the cell division process that involves division of a diploid (2n) mother cell and…
Q: Which cell secretes the matrix for bone formation? a) Osteoclastoma b) Osteoclast c) Mesoblasts d)…
A: Introduction :- The bone matrix is the component of the bone tissue that makes up the majority of…
Q: .What is the bottleneck effect?
A: Introduction In this question we will discuss about the
Q: Natural selection favored dark-colored fur in the rock pocket mouse. The selective force on the…
A: Natural selection It is a natural biological process where organisms adapt and change there…
Q: What slide preparation technique should you use for the following research goals? Briefly justify…
A: Microscope is an optical instrument which has major application in visualizing very small to…
Q: Diagram a translocation arising from repetitive DNA.Repeat for a deletion.
A: Changes in the structure of chromosomes may create issues with the body's systems' development,…
Q: Which of the following is true about neglected tropical diseases? Group of answer choices Though…
A: * Neglected Trophical disesase commonly seen in countries like Africa and Asia and Latin America…
Q: Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А B
A: *pictomicrographs shows the photograph of objects under a microscope. * objects like metal and…
Q: What similarities and what differences between the graphs? What antibiotics were the most…
A: These graphs are based on the observation of bacteria collected from cave and were tested for…
Q: Rice Malze Wheat Millet Sorghum 05 cereal crops provide 60% of the food energy taken in by the…
A: Cereal Cereals are the kind of grass that are cultivated for their grains.
Q: true or false: meiosis takes place in body cells called somatic cells.
A: Meiosis is a double division which occurs in a diploid cell and gives rise to four haploid cells…
Q: Explain the process of DNA replication.
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: Pruning results in a greater photosynthetic area and therefore lesser foods are manufactured? True…
A: Introduction Pruning is when you selectively remove branches from a tree, It allows room for new…
Q: First find and label ATP Synthase on the diagram below. Make boxes and add the labels for ATP, ADP,…
A: Cellular respiration takes place in four steps glycolysis where glucose is converted into pyruvate.…
Q: Question 33 RNA polymerase II: A is located in the nucleoplasm and transcribes the protein-encoding…
A: Transcription is the process which is required for formation of mRNA from template strand of DNA.
Q: Please could you explain how lymphocytes (especially B) can maintain receptors on their surfaces? Is…
A: Introduction A lymphocyte is a type of white blood cell found in most vertebrates' immune systems.…
Q: DNA ligases will seal all nicks there are in the DNA strands during the replication process and in…
A: DNA nicks introduced during the process of replication, recombination or repair if left unchecked,…
Q: 1. What is special about the saliva of openbills?
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 1. What is a casque? Which members of Casuariiformes have one, and what is though to be its…
A:
Q: Which factor is not required for natural selection to occur?
A: This question is based on evolution and natural selection.
Q: f you lost your ability to walk, could you access all of your house? What would need to change?…
A: Whenever one loses their ability to walk, they become wheelchair bound. Hence, their house, car…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: 2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the…
A: bp = base pair—one bp corresponds to approximately 3.4 Å of length along the strand 1angstrom (Å),…
Q: How can a mutation be beneficial?
A: Mutations are defined as any sudden inheritable change in the DNA or genetic material of an…
Q: List some of the ways that humans use fungi.
A: Introduction :- Fungi can be single-celled organisms or multicellular organisms with a great deal of…
Q: 3. Listed within this chart are descriptions of a variety of DNA mutations. Your job is to fill in…
A: *Mutations cause change in DNA sequence thar are resulted from DNA copying errors during cell…
Q: This figure can be used to represent the sequence of events leading to the evolution of dark-furred…
A: Evolution is the change in the characteristics of a species over several generations and relies on…
Q: In a Hardy-Weinberg situation, suppose that 253 out 400 individuals in a population express a…
A: * Hardy Weinberg equilibrium states that the allele frequency and genotype frequencies in a…
Q: Describe how a product generated from glycolysis can be used for ATP production by the electron…
A: * Glycolysis is a metabolic pathway it converts glucose into pyruvic acid and in this process free…
Q: Partial 0.75 /1 pts Question 8 Where is carbon stored on Earth? Check all that apply. V rocks and…
A: Carbon is one of the most important elements to humans since all organic compounds and most…
Q: 1. The group of Leonor and Junior conducted an experiment about the fragmentation of planaria.…
A: In this, the given paragraph includes the experimental process and the observations of…
Q: 13. Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А…
A: A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm.…
Q: Define Compare/contrast it with sterilization, antisepsis and bacteriostasis.
A: As per our guidelines we are not allowed to answer more than one question at a time please ask next…
Q: What are the immunological implications of 'bare lymphocyte syndrome' /MHC deficiency?
A: Introduction - Mutations in some genes of the major histocompatibility complex or genes involved in…
Q: iscuss the intestinal phase of gastric secretion regulation with examples
A: The digestive system is involved in a variety of processes, including food digestion and nutrient…
Q: Sometimes, the young ones born have an extremely different set of eyes or limbs. Give a relevant…
A: The abnormalities in the development of organs in the newborn may result due to various reasons.…
Q: a. Give one reason why a country with a high HIV infection rate may have better quality healthcare…
A: Acquired immunodeficiency syndrome (AIDS) is a caused by a virus named HIV (human immunodeficiency…
Q: Which statement about energy flow in ecosystems is accurate? A.Energy flow reaches an equilibrium…
A: Environmental science is one of the sciences that we must learn that every living thing on this…
Q: An advantage of gas exchange in water, compared with gas exchange in air is that water usually…
A: Gas change is the process by means of which oxygen and carbon dioxide flow among the bloodstream and…
Q: Q.5. If the industries were removed, what impact would it have on the population of moths in…
A: Introduction We will answer the question in below step.
Q: A man infected with a viral respiratory infection sneezes and releases tiny droplets containing…
A: INTRODUCTION Virus It is a microscopic infectious agent contain DNA or RNA as their genetic material…
Please answer asap and type your answer and do not copy from anywhere please
Step by step
Solved in 2 steps
- The activity of the enzyme β-galactosidase produced bywild-type cells grown in media supplemented with different carbon sources is measured. In relative units, thefollowing levels of activity are found:Glucose Lactose Lactose + glucose0 100 1Predict the relative levels of β-galactosidase activity incells grown under similar conditions when the cells arelacI−, lacIS, lacO+, and crp−.CHOOSE THE CORRECT ANSWER. PLS ANSWER. 1.What could be the possible condition that will contribute to the formation and storage of TAGs?A.excessive degradation of muscle proteinsB. too much beta-oxidationC. excess intake of carbohydratesD. increased action of the enzymes of the TCA cycle 2.What of the following molecules can be converted to pyruvate for gluconeogenesis and which is derived from the breakdown of muscle proteins?A.LysineB. AlanineC. LeucineD. IsoleucineRegulation of cellular activities can be modulated by both transcription factors and proteasomes. Select one: a. False b. True
- Answer all 3,4,5.choose correct option and no need to explain long just explain shortly. Thanks 3. Which of the following could lead to increased risk of developing Alzheimer's Disease? A. hypermorphic mutation a-secretase B. hypermorphic mutation B-secretase C. hypermorphic mutation y-secretase D. both A and B E. both B and C 4. In the Sonic Hedgehog signaling pathway, which of the following would promote stem cell differentiation? A. loss of function mutation in GLI1 B. genetic knock-out of SUFU C. hypomorphic mutation of SMO D. over-expression of Shh ligand 5.Using the CRISPR/Cas9 system, a genetically-engineered sgRNA complementary to a target alte in the genome binds to Cas9 endonuclease. A mutation can occur at this site when A Cas9 cleaves the DNA and nonhomologous end-joining results in a small deletion. B. Cas9 cleaves the DNA and homologous recombination with the homologous chromosome is used to repair the break. C. Cas9 cleaves the DNA and nonhomologous end-joining…explain the following prperties of G protein: structure of G- activation cycle and signaling pathway for GaqACTIVITY4; ETC Crossword Puzzle Direction Answer the questions or complete the statements below to fill in the puzzle Across Down 3. Complex lis also known as the 1. Heptachior has been hinked to health issue complex 4. In stage of the ETC, the heptachlor is 2. is when the body has elevated levels inhibited of calcium 6. Complex Il is linked directly to the 5. Rotenone is most commonly found in cycle 8. Complex is inhibited in this pesticide, 7. Rotenone is most abundant in the part of the plant 9. There are (number) complexes in the 10. Heptachlor is commonly spread in ETC form 13. There are (number) ATP produced 11. Complex is also known as the per glucose molecule from the electron Succinate Dehydrogenase Complex transport chain 12. Heptachlor is a man-made substance. 14.type of reaction is used to transfer electrons from electron donors to electron acceptors 15. compound receives electrons from NADH 16. (plant) is where the rotenone comes from 17. in a eukaryotic cell, most of the…
- In contrast to their similar brain abnormalities,newborn mice deficient in Apaf1 or caspase-9 have dis-tinctive abnormalities in their paws. Apaf1-deficient micefail to eliminate the webs between their developing digits,whereas caspase-9-deficient mice have normally formeddigits (Figure Q18–1). If Apaf1 and caspase-9 function inthe same apoptotic pathway, how is it possible for thesedeficient mice to differ in web-cell apoptosis?NO answer needs more than 2 sentences, some require just a couple words. 7. GTP-y-s is an analog of GTP that cannot be hydrolyzed. How would you expect a Co-IP experiment between G-alpha and G-beta proteins to differ in the presence of GTP-y-a and GDP? 8. An epithelial cell line expressed a fluorescence-based cAMP biosensor in all cells, but only expressed a GPCR in ~30% of those cells. When you treated the cells with the GPCR ligand, fluorescence from the cAMP sensor immediately turned on in most cells (not just those expressing the GPCR). In one sentence suggest a simple explanation for why cAMP increased in non-GPCR-expressing cells. 9. Taxol is a drug that inhibits microtubule dynamics and is often used for cancer chemotherapy because it preferentially affects dividing cells. What microtubule-based structure is likely disrupted by Taxol so that it specifically affects proliferating cells? 10. Patients with Marfan’s syndrome have a mutation in the fibrillin gene and are at risk of…Brown and Goldstein won the Nobel Prize for discovering the molecular basis of familial hypercholesterolemia (FH). The key experiment that led to the breakthrough was that cells from FH patients responded to LDL by increasing cholesterol biosynthesis. True or False
- Hi, can you please explain the clinical significance of G protein mutations.It is not an easy matter to assign particular func-tions to specific components of the basal lamina, sincethe overall structure is a complicated composite materialwith both mechanical and signaling properties. Nidogen,for example, cross-links two central components of thebasal lamina by binding to the laminin γ-1 chain and totype IV collagen. Given such a key role, it was surprisingthat mice with a homozygous knockout of the gene fornidogen-1 were entirely healthy, with no abnormal phe-notype. Similarly, mice homozygous for a knockout of thegene for nidogen-2 also appeared completely normal. Bycontrast, mice that were homozygous for a defined muta-tion in the gene for laminin γ-1, which eliminated just thebinding site for nidogen, died at birth with severe defectsin lung and kidney formation. The mutant portion of thelaminin γ-1 chain is thought to have no other functionthan to bind nidogen, and does not affect laminin struc-ture or its ability to assemble into the basal lamina.…1. Do monoclonal tumors have a higher chance of reaching malignancy compared to polyclonal tumors? 2. The question pertains to cancer cells exhibit an altered energy metabolism. The breakdown of one glucose yields two molecules of ATP via glycolysis so why thorough aerobic conditions is there such an abundance of ATP? Please answer both!
