15. Process by which an organism moves towards or away from a chemical stimulus. ______________16. An allele that expresses itself only when an identical allele is present. ______________17. The passing down of genes from one generation to the next.

Q: If the gene is named Fh and the disease allele is Fh and the wildtype allele is fh, give the…

A: Familial hypercholesterolemia (Fh) is a genetic disease caused by mutations in the LDLRAP1 gene. the…

Q: What will happen to the person if she/he had more than or less than 46 chromosomes?

A: Each human cell ordinarily has 23 pairs of chromosomes, for a total of 46 chromosomes. A shift in…

Q: Homozygous dominant

A: Homozygous means same type of alleles.   Dominant means with dominant alleles which express.

Q: Which one is most likely the father? Mother Child Dad 1 'Dad 2 Dad 3

A: DNA finger printing is a technique used in forensic medicine. This technique helps to identify the…

Q: Directions: Read the paragraph and answer the questions. Write your answer on a separate paper.…

A: Answer 1- the mothers of 3 and 6 are carrying the gene of haemophilia as recessive alleles. They do…

Q: Mr. Jones Mrs. Jones Color blind Homozygous for normal vision Color blind Normal vision Carl Dale In…

A: Color blindness is a well-known term that they are usually defined as a hereditary disorder caused…

Q: Mutiple Choice:  Write the correct answer on the space provided. _______1. Any chromosome other…

A: Chromosomes are present inside the cell nucleus and made up of DNA (Deoxyribonucleic acid) molecules…

Q: 1. The prefix hyper means above. 2. The study of skin is referred to as biology. 3. Nonconstructed…

A: Medical terminology  It is essential to know the medical terminology basics to understand the…

Q: Comment in not more than 30 words these lines.  “ No two people are exactly alike. Even…

A: Dizygotic twins also known as fraternal twins are formed when the sperm fertilize two separate eggs…

Q: common molecular marker,

A: Molecular marker: It is a fragment of DNA which is associated with a certain location within the…

Q: li fraumeni syndrome history 2. How it is linked with genetics

A: Autosomal dominant diseases are those that affect both parents when the child is affected by the…

Q: What are: Lung cancer radiation therapy Physical Examination

A: Cancer is uncontrolled growth of cells.  These cells are not regulated by the checkpoint in the cell…

Q: My Diagnosis for Patient C Sex: Chromosomal Disorder: Justification:

A: Karyotype can be defined as a numbers ;size and shape of metaphase  chromosomes.It involves the…

Q: Definitions of phenotype, genotype, allele, gene, microevolution, macroevolution

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 3 Mother's genotype Father's genotype 4. Father's genotype = Aa Mother's genotype = aa = Aa = AA A…

A: Since you have asked multiple questions , we will solve the first question for you. If you want any…

Q: Cystic fibrosis is an inherited recessive disorder. A genotype which would suggest that an…

A: Cystic fibrosis is a homozygous recessive disorder which affects the lungs .

Q: common household item that looks like the ovary and testes

A: Figs seeds hang in twos when they grow looks as  two testis in scrotum.

Q: Paragraph Styles Editing Voice Font 50) Read and answer questions about a pedigree that shows the…

A: Pedigree analysis is the type of inheritance analysis in which the symbolic representation of the…

Q: PUNNETT SQUARE: GENOTYPES: BB Bb - bb – PHENOTYPES: Belted -: Non-belted-;

A: A Punnett square is used to understand a typical monohybrid and dihybrid cross conducted by the…

Q: Complete the punnett square for the following: Matt has blood type B and is heterozygous.  Sue has…

A: The A and B genes are dominant and the O gene is recessive. For example, if an O gene is paired with…

Q: dentify if this is a rate, a ratio, or a proportion. number of women in Calatrava who died from…

A: The statistical study of human populations is known as demography. Demography aims to study the…

Q: tables attached to complete the punnett square   Eye color Parental genotypes: ______ X ______…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Please help me answer this reviewer. Write the word TRUE if the statement is correct and if not,…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: The germ cell layer that forms the brain and spinal cord.   2. The embryonic folding that results…

A: NOTE:- “Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Body Covering: DNA: GGGAGTGTATACGGGATGAAGGCGATT MRNA: 12 protein: phenotype:

A: To make proteins transcription happen, which mean DNA(genes)>copy of gene>protein, this is the…

Q: Teratology is the study of exogenous chemical compounds (teratogens) that have the capacity to cause…

A: Teratogens are chemicals or physical agents taken during the pregnancy that harms the growth and…

Q: Interpreting the karyotype Lab technicians compile karyotypes and then use a specific notation to…

A: Karyotyping refers to the photographic arrangement of the complete set of individual's chromosome in…

Q: Write the word TRUE if the statement is correct and if not, underline the word or statement that…

A: Biomolecules are molecules produced by the cells to fulfill its activity for the cell or organisms…

Q: difference of ideogram and karyotype

A:

Q: Inferior to the umbilical region

A: Human Anatomy is often defined as the study of structures in the human body. Anatomy focuses on the…

Q: What type of chicken is this

A: The chickens are domesticated fowl belonging to subspecies of the red junglefowl. Chickens are…

Q: ich of the following has the same genotype but different phenotype wo brothers lentical Twins…

A: Genetic constitution of an individual is referred to as genotype where as how the individual appears…

Q: Presentation: 32 year old male presents with four genital lesions which he states have been present…

A: Genital herpes is one of the most common sexually transmitted infections in male and females due to…

Q: meaning of species

A: Taxonomy is a system for hierarchical classification and identification system for species.Carl…

Q: Twins may or may not be identical. Comment.

A: Fertilization is the fusion of gametes to initiate the development of new individual organism or…

Q: What are the chances that Ann and Michael next child will have the disease. Assume people marrying…

A: Pedigree analysis The formal study of the pattern of a trait in a pedigree to determine such…

Q: Tell me whether it is autosomal reccessive inheritance,autosomal domiant inheritance,sex-linked…

A: Autosomal recessive inheritance: It has following  characteristics.  traits often skip generation…

Q: detacched earlobe phenotype and genotypes

A: A genotype is the genetic makeup of an organism. Phenotype is the observable morphological…

Q: Tell me whether it is autosomal reccessive inheritance,autosomal domiant inheritance,sex-linked…

A: To determine the inheritance pattern of any trait we need to do pedigree analysis. Here the trait…

Q: What do you mean by labium?

A: Vulva includes external sex organs in females. Sex organs are involved in establishing sexual…

Q: Identify one human trait, other than skin tone, eye color and stature, that you think has a clinal…

A: Those traits which are genetically inherited often have a clinal distribution.  In these traits…

Q: Characteristics (Manifestations) of-9 life through which we cannot understand the life of living…

A: Any biological, living system that acts as a separate entity is referred to as an organism. Cells…

Q: help writing out the complete Geno type? attached lobes = e straight hair = C' mouth full lips =…

A: Traits are controlled by alleles, that present in chromosome and present in alternatives from, if…

Q: Which of the males is the father?  -male1  -male2  - cannot tell from this gel

A: Child should receive DNA from either mother or the father. Some from the mother some from the…

Q: The genotype of the individual with the arrow is O O A) Aa B) Xaya C) xAxa D) aa 10 마음 게

A: Inheritance or heredity is passing on one trait from the parents to the progeny by either asexual or…

Q: No need for explanation, only answers #4-#10

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Draw a Punnett square for a mother that is a carrier of hemophilia and a father that is not…

A: The Mendel's laws of independent assortment states that the separation of a paired group of…