18. All the followings can be produced through Industrial Microbiology techniques except: a) antibiotics b)  Amino Acids c) steroids d) polysaccharides

Q: If one did a research and the purpose was Identifaction of Fungal specifically Mushrooms Using…

A: If the purpose of the research was the identification of fungi, specifically mushrooms, using…

Q: A mutation in the coding region of a gene may alter the of the gene. protein-coding region may alter…

A: Mutations are changes in the DNA sequence of an organisms genome. DNA is the genetic material that…

Q: Research both arguments regarding the safety of GMO use in foods. Based on the evidence, are GMOs…

A: GMO refers to a genetically modified organism, it is any organism i.e., plants, animals or…

Q: During the cycling of neurotransmitters in the axon termini, the fusion of the neurotransmitter…

A: When an action potential arrives at the axon terminal it triggers the opening of voltage gated Ca2+…

Q: The nucleus  a) has a single membrane and compartmentalizes the genetic material b) has a double…

A: The nucleus is a membrane-bound organelle found in eukaryotic cells. It contains the cell's genetic…

Q: How does RNA regulate gene expression? Specifically what is the pathway siRNA and miRNAs regulate…

A: The genes are expressed when the genetic codes of the DNA are fully converted into the protein…

Q: A. Find information from 1 of the 3 sizes that are below  Small 1.finches 2. Parakeets  Medium…

A: Restriction refers to a method of immobilizing a bird, such as a Cockatiel, to prevent it from…

Q: If hypertrichosis was an incomplete autosomal dominant trait, rather than a complete dominant trait,…

A: An autosomal dominant trait is a pattern of inheritance where a single copy of a gene mutation on…

Q: Define drug dependence and explain the difference between physical dependence and psychological…

A: A drug is a substance that, when introduced into the body, can change the way the body functions.…

Q: Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger…

A: Sickle cell anemia is a genetic disorder affecting the structure and function of hemoglobin, a…

Q: 1which test is used to differentiate between fermentative and oxidative metabolism?describe the…

A: 1.The test used to differentiate between fermentative and oxidative metabolism is the…

Q: 8. The table shown below represents the number of species growing in an area that was logged using…

A: a) The table shows that in the first five years after logging, the number of grass species decreased…

Q: 5. Drawing upon the results of this exercise, why is Pseudomonas aeruginosa of such concern in burn…

A: Pseudomonas aeruginosa is a common bacterium that poses a significant threat to certain vulnerable…

Q: What will happen to the oxygen and carbon dioxide levels in a sealed container with a: a. C3 plant…

A: C3 plant: C3 plants are photosynthetic organisms that use the C3 pathway to fix carbon dioxide…

Q: Consider the below transporter: for 2 Na+ that get in 1 molecule of glucose enters. What is the…

A: To determine the maximum ratio of glucose concentration, we need to consider the equilibrium state…

Q: what were some of the change over time that happen in whale science, identify the major discoveries…

A: The whale population define to the number of whales, which are big (larger) marine mammals belonging…

Q: Under normal conditions, an mRNA molecule that is 99 bases long will create a protein composed of: -…

A: Note: According to bartleby guidelines only first three subparts are to be answered. So please…

Q: During SDS-PAGE, glycoproteins migrate as relatively diffuse bands, whereas nonglycosylated proteins…

A: SDS-PAGE, short for Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis, is an analytical…

Q: Vascular plants sequestered large amounts of CO2 through photosynthesis when they first expanded…

A: A glaciation is an event resulting in either formation or growth of glaciers due to huge…

Q: Main question I need for notes: If evolution is true then why do new species seem to appear out of…

A: The geologically changed remnants of a formerly lived organism and/or its behavior are called…

Q: Chocolate is made by mixing sugar with chocolate liquor. dissolving cocoa powder in animal fat.…

A: Chocolate is a widely consumed confectionery product having a sweet to bitter taste doing to its…

Q: 5. Below is the survivorship growth curve- (C) a) What does the x-axis on the graph in Model 2…

A: A survivorship growth curve is a graph that shows the number or proportion of individuals surviving…

Q: What makes a trait susceptible to reversals in a phylogeny (microbial diversity)?

A: The variety of microorganisms found in a certain environment such as soil, water, air, or living…

Q: Which of the following decrease gene activity? a. acetylation of histone proteins b. methylation of…

A: Epigenetic modifications are heritable changes in gene expression that occur without changing the…

Q: Which of the following is the most likely target of retinoblastoma protein (RB)? a kinase…

A: Retinoblastoma protein (RB) is a tumor suppressor protein that plays a crucial role in regulating…

Q: In species with internal fertilization, the eggs often are attached to the outside of the female's…

A: Brood chambers are specialized structures in some species with internal fertilization that provide a…

Q: How do inactivated vaccines prevent disease? Briefly describe what an inactivated vaccine is and…

A: Inactivated vaccines are a type of vaccine that contain killed or inactivated microorganisms, such…

Q: Which of the following is true regarding water? O It makes up approximately 10% of the human body It…

A: Water plays a key role in variety of functions in the living organisms. Some of the key roles of…

Q: Measure the migration of each band in the marker lane from the well. Using a semi-log scale, plot…

A: Electrophoresis is defined as the migration of charged particles under the influence of an electric…

Q: Consider a cross of pea plants where RR is expressed as a RED flower, Rr yields flowers with both…

A: A monohybrid cross is a genetic cross between two individuals that differ in one trait which is…

Q: 50) Genetic engineering is considered the new ___________ revolution in microbiology. a) genetic b)…

A: Genetic engineering also known as genetic modification or recombinant DNA technology involves…

Q: 1.How is acid or alkaline detected in a culture medium as an end product? 1.The tests for the…

A: Biochemical tests are laboratory techniques used to identify and characterize different types of…

Q: What effect would there be on C3 and C4 plants for increased oxygen levels? Why? Explain its effect…

A: Photosynthesis is the process by which green plants, algae, and some bacteria use energy from…

Q: What specific “instructions” do COVID-19 vaccines provide our body cells? And  in what year did Dr.…

A: COVID-19 is the disease which is a pandemic disease caused by a virus belonging to the coronavirus…

Q: In thinking about the clinical application of phylogenetics, discuss the role of phylogenetics in…

A: The study of evolutionary links between various biological species or groupings is known as…

Q: Based on the diagram, which of the following pairs of organisms have the closest evolutionary…

A: A phylogenetic tree is a branching diagram that depicts the evolutionary relationships among a group…

Q: Which of the following factors DOES NOT affect pluripotency? O DNA Acetylation Oct4 Nanog miRNA's…

A: Pluripotency is the ability of stem cells to differentiate into all the cell types of an organism.…

Q: for the species : wood pecker  provide the following information: 1. Species name/common name…

A: Species name/common name: The species name of woodpecker is Picidae, which belongs to the family…

Q: genes traces family 1 +0.0 in a pedigree chart can show Human Genetics Terms picture chromosomes…

A: The field of human genetics seeks to understand the complex relationships between genes, inheritance…

Q: 5. Which organisms do leopard seals eat? 6. Which organisms eat krill? 7. What producer(s) can be…

A: When various food chains are interconnected to each other it becomes entangled and forms a food web.…

Q: Hypothesis Creation Develop a hypothesis that is of interest to you! Examine relationships between…

A: Hypothesis: Increasing temperatures in the NEON data said our correlated with delayed fall leaf…

Q: You are studying the diet of American bison. You gather the data in the graph below on the effort…

A: The heterotrophic organisms are unable to produce their own food and for this reason they depends on…

Q: Methicillin-resistant Staphylococcus aureus is which of the followin only spread through sneezing.…

A: Methicillin-resistant Staphylococcus aureus, commonly known as MRSA, is a type of bacterial…

Q: The junctional imprecision resulting from the random insertion or deletion of nucleotides to the cut…

A: V(D)J recombination is a process of genetic rearrangement that occurs during the development of…

Q: Explain how the human voice is produced. Describe briefly how each of the three main components of…

A: Voice is the vibration of sound that plays an important part in human life. An individual can…

Q: Which of the following is an example of a post-translational modification? Select an answer and…

A: Post-translational modifications (PTMs) are chemical modifications that occur on a protein after it…

Q: Describe and differentiate the development of the membranous and cartilaginous neurocranium.

A: The portion of the skull that houses the brain is called the neurocranium. The two primary parts of…

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: Is the concept of infectious dose applicable to Covid -19 infections? Why/Why not?

A: The "infectious dosage" is the quantity of a pathogen needed to cause an infection. It is improbable…

Q: Between which two markers is the F factor located in strain 4? strain early late 1. 3. 5. O X and A…

A: This question is asking about the location of the F factor in strain 4. We need to identify the two…

Industrial Processes

Industrial processes result in the manufacturing of products (biological products, such as enzymes, medicine) on a large scale using different methods, such as physical and chemical procedures. Few products such as pharmaceuticals, agricultural products, food items, etc., involve microbes and their enzymes. Such processes are termed industrial biological processes. Microbiology and biotechnology enable us to utilize the ability of microorganisms to produce enzymes, primary metabolites, and secondary metabolites, which in turn help to produce the desired products.