***18. Complete this flowchart to show how different alleles can result in different characteristics. In the DNA, different alleles of a gene have a different sequence of > different sequence of in transcription > different sequence of in a protein translation different structure and function of the protein (e.g. normal enzyme vs. defective enzyme) > different characteristics (e.g. normal color vs. albino)

***18. Complete this flowchart to show how different alleles can result in different characteristics. In the DNA, different alleles of a gene have a different sequence of > different sequence of in transcription > different sequence of in a protein translation different structure and function of the protein (e.g. normal enzyme vs. defective enzyme) > different characteristics (e.g. normal color vs. albino)

Name: In the DNA, different alleles of a gene have a different sequence of*
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: In the DNA, different alleles of a gene have a different sequence of***18. Complete this flowchart to show how different alleles can result in different characteristics.different sequence ofintranscription> different sequence ofin a protein translat

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Each of these six terms fits into one (and only one) of the following blanks: bases, proteins, amino acids, genes, chromosomes, codons. Write the letter corresponding to each space and then write which of the five terms goes with that letter. For instance, if you think the answer to space “a” is “chromosomes,” write a = chromosomes. DNA is found on pairs of ______a_______. ______b_______ are series of three _____c_____ that code for particular _____d_______. _____e_____ are specific strings of codons. Amino acids are put together to form ________f______.
A noncoding DNA sequence within a gene is called a(n) _____________.
The formation of a double-stranded structure must obey the rule that adenine hydrogen bonds to thymine (or uracil) and cytosine hydrogen bonds to guanine. Based on your understanding of genetics (from this course or a general biology course), discuss reasons why complementarity is an important feature of DNA and RNA structure and function.
If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its complementary strand? 5’ACCGATTACGATTACG3’ If the template DNA strand has the nucleotide sequence below, what is the nucleotide sequence on mRNA? 5’ACCGATTACGATTACG3’ In the chart below, indicate the unique structural or functional characteristics of DNA and RNA, as well as their similarities. Be very specific. Unique DNA characteristics Similar characteristics Unique RNA characteristics
A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first cytosine base with guanine base b. Replacement of final thymine base with guanine base c. Replacement of second guanine base with cytosine base d. Replacement of first thymine base with adenine base
Which of the following describe how the order of nucleotide bases along a gene in the DNA ultimately determines the primary structure of a protein and how the primary structure ultimately determines the three-dimensional shape and function of the protein coded for by that gene. A Certain amino acids in a protein interact with other amino acids in that same protein and so the order of amino acids ultimately determines the 3-dimensional tertiary structure of that protein. B The order of nucleotide bases along the DNA is transcribed into complementary tRNA which is translated into the correct amino acid sequence for the protein by mRNA. C The order of nucleotide bases along a gene determines the order of amino acids in the resulting protein. The order of amino acids in the protein is called its secondary structure.
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3
A small section of a gene for a protein has the following nucleotide sequence:CTG GGA TCC TAA GGTWhich of the following mutations would cause a nonsense mutation in the sequence shown above? Select one: a. Replacement of second adenine base with a cytosine base b. Insertion of guanine base after the first thymine base c. Insertion of guanine base after the first adenine base d. Replacement of second cytosine base with a adenine base
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid sequences that have been left blank. DNA______ ______ ______ ______ ______ ______ ______ ______ ______ mRNA A U G A C U A G C U G G G G G U A U U A C U U U U A G AA______ ______ ______ ______ ______ ______ ______ ______ ______
A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first guanine base with cytosine base b. Replacement of first thymine base with cytosine base c. Replacement of second thymine base with adenine base d. Replacement of seond guanine base with adenine base