2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked with designing 2 primers to clone this gene by PCR amplification. What are the sequences of the two 21bp primers in the 5' to 3' orientation that will allow you successfully amplify this gene? АTGTTTGTTTTСТTGTTTTATTGССАСТАGTСТСТAGTCAGTGTGTTААТСТТАСААССAGAACTCAATTAСССССТGCATAСАСТААТТСТТТСАСАС GACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAA/ O A) ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA O B) TAAAACAAGAAAAACAAACAT and TTATGTGTAATGTAATTTGAC O C) ATGTTACTTGGTGACCAGTTG and GTCAAATTACATTACACATAA O D) ATGTTTGTTTTTCTTGTTTTA and TTATGTGTAATGTAATTTGAC

Q: Valve #23 is a ______ valve based on its structure and based on which blood vessel is bring the…

A: Blood goes passes through a valve prior to leaving each chamber of the heart. The valves stop the…

Q: Which of the following best describes blood plasma? Group of answer choices found inbetween the…

A: Hi! Thank you for your question. As you have posted multiple questions and have not mentioned which…

Q: Explain the Organization of the Thylakoid Membrane ?

A: Thylakoid can be described as the sac like structure inside the chloroplast. It is the site for the…

Q: Answer the following questions for a person deficient in sucrase. 10. Which one major nutrient group…

A: 10. A person deficient in sucrase will lack the ability to digest particular kinds of sugars i.e.…

Q: nasalis muscle.   procerus muscle.   depressor anguli oris.   frontal belly of the occipitofrontalis…

A: Odour is sensed by the receptors present in the nose known as olfactory receptors. The bad odour…

Q: Item 28 Item 28 The type of muscle fibers that are striated, form Y-shaped branches, and are…

A: The tissue derived from embryonic mesoderm, and involved in movement and locomotion by virtual of…

Q: Match each layer of the meninges to its description. (1) dura mater (2) arachnoid mater (3) pia…

A: We can say that The central nervous system(CNS) is the major organ system that controls most of the…

Q: What happens when there is deficiency of histamine in the body?

A: Histamine is a physiologically active substance that may be found in a wide range of living…

Q: Describe the difference in maximal force capacity in the knee extensors vs the knee flexors. What…

A: Knee flexion is defined as the bending of the knee to bring the foot toward the posterior thigh, and…

Q: Column A A. Relationship with peers, friends, relatives, etc. B. The period between birth and 1-2 1.…

A: Different types of terms which are given in column A is required to match with coloum B. The…

Q: Which phrase correctly describes seroconversion?

A: The study of serum and other bodily fluids is referred to as serology. In practice, the phrase…

Q: 3. In the Small Intestine: a. Is there digestion? YES or NO b. If YES, then answer i-iv to explain.…

A: 3. a) Yes, Digestion occurs in small intestine. i)  Peptidase, sucrase, maltase, lactase, lipase,…

Q: Describe the general anatomy for pelvic floor injury.

A: The pelvic floor is referred to as a funnel-shaped muscular sheet attached to the walls of the…

Q: Item 26 Item 26 With increased age, skeletal muscles show Multiple Choice a decrease in the…

A: Muscle- Muscles is a contractile tissue are located everywhere inside the body and are responsible…

Q: A 3-month old baby boy suffers a heart problem. His immune system is too weak to fight infections…

A: Endocrine gland is a gland which liberate it's substance not into blood vessels but into blood so…

Q: Unlike arterial fluids, cavity fluids do not generally contain ___..     aldehydes      alcohols…

A: Cavity fluids are those fluids which are used to treat the contents of the hollow lumens of the…

Q: Please match the early developmental structure on the left with the human structure it develops into…

A: Fertilization is a process in which male and female gametes fuse with each other to form Zygote .…

Q: The endocardium lines the chambers of the heart and

A: Mammalian heart is made up of 4 chambers such as 2 atria and 2 ventricles while heart of other class…

Q: Sympathetic stimulation of the respiratory system cause _________ of the airway.     no change in…

A: The part of the nervous system that controls bodily functions which are not controlled voluntarily…

Q: Atrial natriuretic peptide lowers blood pressure by increasing sodium reabsorption decreasing sodium…

A: Urinary system is a type of body system which is involved in formation of urine and finally…

Q: Suppose that a sensory neuron in the periphery generates a trainof action potentials, and…

A: The nervous system Is made up of nerve cells and it is responsible for maintaining many mechanisms…

Q: 09

A: We can say that The lower extremities called the lower limbs consists of three regions called the…

Q: - COMPLETION: Complete the table below, supply the oiven DNA template to its co correct codon and…

A: Introduction:

Q: Define osmosis and describe the effects of placing red blood cells in the following solutions 1,…

A: The important substances both organic and inorganic are required by the cells to perform metabolism…

Q: Explain how exchange nutrients and waste products between food and tissue cells & interstitial fluid

A: Nutrients are essential for body for performing various activities.Waste are final product remained…

Q: Characterize the thickest layer of the ventriculus.

A: Ventriculus is a type of digestive organ which is used in the process of breaking down food…

Q: This is a Peripheral Nerve, longitudinal section, please use ARROWS to label the following: Axon…

A: The peripheral nervous system is one of two parts that make up the nervous system of  bilateral…

Q: Henry Gustav Molaison (H.M.) suffered from profound anterograde amnesia after his ________________…

A: INTRODUCTION Seizures are disorders in which the connection between two nerves cells is…

Q: ERGONOMICS Why do engineers need to learn and have knowledge of anatomy and physiology?

A: Engineers are best known for their supreme ability to design, build or repair devices, machines,…

Q: Why is an understanding of gene regulation in eukaryotes crucial to an understanding of…

A: We know that  Every organism has different sets of genes that regulate different gene expressions.…

Q: Digestion of the cheese and meat FATS: 8. In the Stomach: a. Is there digestion? YES or NO b. If…

A: Digestion is the process in which the large, insoluble, chunks of food are converted into smaller,…

Q: Answer this question asap quickly order

A: Homeostasis-We can say that  It is the condition when the body's internal environment is balanced.…

Q: 14. Synovial joints, like knees and hips, are sometimes replaced with artificial joints (like in…

A: We can say that Artificial joints or prosthetic joints are the replacement joints used in place of…

Q: complete the Case Study exercise below. Read the scenario and answers the I questions. Your…

A: Osteology is a subtopic under anatomy that deals with the study of bone that includes parts of the…

Q: Valve #18 is the _____valve based on its structure and is also called the ____ based on its…

A: The valves stop the backward progression of blood. These valves are folds that are situated on…

Q: The medication Zantac→ that Sam took for the pain relief is an H2 blocker (receptor antagonist).…

A: The digestion and absorption of nutrients by the digestive system is under the control of neural and…

Q: Explain the mechanism by which indoleamine hallucinogens affect the brain, include their effects on…

A: Indoleamine 2, 3-dioxygenase is a catabolic compound protein that functions to hinder digestion in…

Q: Differentiate Haversian canal from Volkmann’s canal

A: Bone is robust structure and is a part of connective tissue which imparts structural support to the…

Q: Multiple Choice gap junctions that connect neurons to smooth muscle cells. varicosities of a…

A: Smooth muscles as the name imply, are smooth in appearance with no striations. These are also…

Q: Define the uses of Sanger sequencing technologies ?

A: Deoxy ribonucleic acid DNA is a molecule used in the development and functioning of all known living…

Q: For iron deficirncy anemia, write Causes and Pathophysiology

A: Iron deficiency anemia refers to a condition in which there are too few healthy erythrocytes in the…

Q: Explain how glucagon and insulin work antagonistically to regulate blood glucose levels. Draw a…

A: Pancreas is basically both exocrine gland as well as endocrine gland. It is also known as mixed…

Q: conclusion about specialized connective tissue

A: Connective tissue- These are the types of tissues made up of gel, fibers, and cells. They are…

Q: A patient has been ill for several days with a severe case of stomach flu. Due to the excessive…

A: Given, that the patient was suffering from stomach flu and had excessive vomitings. Due to excessive…

Q: Why polycystic ovarian syndrome produces chronic anovulation? Can you explain in detail - thanks!

A: Polycystic ovarian syndrome (PCOS) is the most common hormonal disorder in women of reproductive…

Q: lease explain the effects of how fiber and water assist the human body of riding  itself of toxins?…

A: Water is the most abundant component of the human body and is required for cellular balance and…

Q: Please read the prompt and answer question 4 and answer ALL its subquestions. Please mind the word…

A: The breakdown of the large food molecules which are insoluble into water soluble food molecules to…

Q: Give some examples of commercially valuable biotechnology products ?

A: Biotechnology essential details with industrial scale production of biopharmaceuticals and…

Q: Please read the prompt and answer question 6 and answer ALL its subquestions. Please mind the word…

A: The breakdown of the large food molecules which are insoluble into water soluble food molecules to…

Q: Describe the characteristics of the three types of levers in the body

A: The movement in the human body is combined affect of the bones, contraction of the muscles and the…