2. A nursing mother who has an alcoholic drink secretes alcohol into her milk for two to three hours afterward. Thus, feeding her child during this time will child to alcohol. Alcohol also will decrease her oxytocin production. How will a decrease in this hormone affect the woman's ability to breast-feed? expose the affoct

Q: The bond is found in protein and linked the amino acid is

A:

Q: Given the following information about the inheritance of characteristics in pea plants, answer the…

A: 1. Different gametes produced by the female plant= yyRrBbssll Using formula = 2n n=  number of…

Q: Dekaylen umber of human diseases result from chromosomal abnormalities. Individuals with cri du chat…

A: Cri-du-chat syndrome, often called 5p- (five p minus) syndrome, is a chromosomal disorder caused by…

Q: 1. What is the source of maltose? a. Small intestine brush border (microvilli) b. Pancreas c.…

A: Maltose is the disaccharides carbohydrate which is digested by the maltases Secreted by the…

Q: Something with a pH of 5 would be A) acidic B) alkaline C) neutral D) basic

A: Acidic and basic are two extremes that describe a chemical property chemicals. Mixing acids and…

Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…

A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…

Q: A black mare is crossed to a chestnut stallion and a bay colored son and a bay colored daughter are…

A: Answer given in step 2 onwards. Please find attachment. Thank you

Q: What is the frequency of alleles in this population? a) CB (p)= 0.2 CG (q)= 0.8 b) CB (p)= 0.3 CG…

A: In the question, a picture is given that is the representation of a population where the green…

Q: 5. 5. Draw a phylogeny the following taxa: shark; tuna; frog; lizard; mouse; whale. On your…

A: Evolution solved the challenge by developing the cellular differentiation process, which resulted in…

Q: Which of the following is inhibited by increased concentration of NADH? Krebs cycle Pyruvate…

A: Molecules like ATP, ADP, NADH regulate enzymes involved in cellular respiration.  In pyruvate…

Q: The 2C units of acetyl CoA necessary for fatty acid synthesis in the cytosol comes from the 6C…

A: Fatty acid synthesis It is the process of the formation of fatty acids from 2 carbon molecules…

Q: The diagram below represents results of agarose gel electrophoresis performed after PCR…

A: Please follow step 2 for detailed explanation.

Q: Multicellular organisms exhibit a hierarchy of cellular organization. The diagram below shows four…

A: On a scale of small to enormous, living beings are highly organized and arranged in a hierarchy. As…

Q: Renal threshold for glucose is ---- mg/dl

A: In physiology, renal threshold refers to the concentration of a substance dissolved in the blood,…

Q: ewith a long tailed mouse. Multiple cresses of this short-tailed mouse to long-taled mice produces…

A: Answer given in step 2 . Please find the attachment. Please provide clear image in future. Thank…

Q: 4. Show a cross for a sickle cell inheritance of a woman who is homezggus, for the disease and a man…

A: Sickle cell disease (SCD) is a group of inherited RBC-related disorders in which the red blood cells…

Q: Is this type of ETi sweets harmful? Wale "up wafer with COCoa cream

A: Is the sweets like water with cocoa cream harmful?

Q: 2. Why do we use samples in the collection of data?

A: A research proposal is a document that specifies the aims of their research and the techniques that…

Q: 7. A nail driven into the side of a tree will remain at exactly the same distance from the ground…

A: Angiosperms: Flowering plants, also known as angiosperms, are plants that produce flowers and…

Q: Which of the following statements about natural selection is not true? O Natural selection operates…

A: Natural selection is the process through which individuals with various phenotypes survive and…

Q: Aside from cleanliness and access to clean water, propose scientific ways in controlling parasitic…

A: Parasitic diseases These are diseases that are caused by a parasite. These are infectious diseases…

Q: Can you explain the answer and how to find it

A: Both parents have blood type LMLN Genotype  Total sex children- Probability of three children have…

Q: 1. Name the receptor indicated by the arrow labeled A. 2. What specific layer of the skin is…

A: 1. Meissner's corpuscle They contain a cutaneous nerve ending responsible for transmission of…

Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…

A: The photochemical and electron transport reactions of photosynthesis process occur at the thylakoid…

Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…

A: Polythiocarbamide ( PTC ) is bitter chemical compound . Sone individual able to taste it while other…

Q: Cancer is classified with the type 1 of DM True False

A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…

Q: The needed to raise one gram of water one degree celsius is called a calorie. A. kilocalories B.…

A:

Q: Explain in 3 paragraphs what is coevolution and its types (pairwise, diffuse, and genefor gene…

A: Coevolution  It is defined as the process of evolution of two species in a mutually dependent…

Q: Can you determine if a plant is a monocot or dicot just by looking at the pattern of the roots? The…

A: Introduction In vascular plants, a vascular bundle is a constituent of the transport system. The…

Q: Please i really need the right answer there is mutiple queshtions and i need the right answer and…

A: B is the correct answer. Multiple alleles occur when there are more than two possible alleles for a…

Q: Question: please provide your thoughts on whether or not melatonin seems to be a good option for…

A: Melatonin occurs naturally in both plants and mammals. Long associated with the regulation of the…

Q: Endosymbiosis states that free-living [ ? ] were engulfed J of and became the [ ]of the eukaryotes…

A: Introduction :- Endosymbiosis occurs when one cell engulfs another, resulting in a coevolved…

Q: Explain in 2-3 paragraphs - Fitness and its relationship with natural selection and adaptation

A: Different organism possess certain traits which may be morphological; physiological which helps them…

Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…

A: Coronory arteries are arteries supplying oxygen rich blood to the heart muscle.There are two main…

Q: what is structural gene and what is non-structural gene? what is the differences between them?

A: Introduction Genetics is the branch of science that deals with genetic material like genome, genes,…

Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…

A: Proofreading by DNA polymerases avoids translesion synthesis by removing freshly generated…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA  contains the genetic information about the characteristics features of te organism present in…

Q: What is the purpose of the following in a Bradford assay? a. PBS b. the Bradford reagent c.…

A: Bradford assay is an assay which is routinely used in laboratories to measure the concentration of…

Q: To describe: The ecological niche of humans.

A: The intended function that an organism performs within an environment is its niche.The biotic…

Q: Using the meta-community concept, is it still possible to conserve species (communities) that are…

A: Habitat fragmentation happens when a big, unbroken piece of habitat, such as a woodland or natural…

Q: QUESTION 12 Consanguinity most often leads to an increase in prevalence (comapred to the general…

A: autosomal recessive disorder.

Q: 1.Fatigue is caused because of formation and depositing of which among the following acids in…

A: Introduction Fatigue:- It is a term used to describe an overall feeling of tiredness or lack of…

Q: To examine: Whether the statement "most intracellular signaling pathways provide numerous…

A: The intracellular signalling network is made up of several signalling pathways that carry…

Q: Question 1 a. What are the potential roles for calcium sparks in cardiac disease states? b.…

A: The ABO blood grouping is regulated by a single gene present on chromosome 9 and such gene is…

Q: Question 6 All of the following are functions of water except? O Acts as a coenzyme in chemical…

A: Water isn't just for quenching your thirst; it's also necessary for keeping your body running…

Q: how should we prepare for the next pandemic? What  project that can be implemented to avoid future…

A: Introduction Pandemic:- A pandemic is the worldwide spread of a new disease, It is a disease…

Q: What is the name of the event where homologous chromosomes find each other in order to line up their…

A: Introduction Cell cycle:- It is the process a cell goes through each time it divides which results…

Q: How might the following findings be understood in terms of the adaptive value of female mate…

A: This is a type of behavioural sexual selection in which the behaviour or the characteristics shown…

Q: VENTILATION FOR PREVENTING PROPAGATION OF POLLUTANTS THROUGHOUT THE ROOM 1. aeration 2. general…

A: Pollutants are defined as the elements or particles that are major contributors to pollution.  These…

Q: 1. Along the coast of Vancouver Island in British Columbia, Canada consists of intertidal zones…

A: Introduction  The term "population" usually refers to the number of people living in a specific…