Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…
A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…
Q: Which of the following are characteristics of minerals? Select all answers that apply. Inorganic Not…
A: Introduction Minerals are necessary for your frame's well-being. Minerals are used by your body…
Q: This type of fertilization happens when the sperm is introduced inside the female body through…
A: The process of fusion of sperm with egg (ovum) to produce zygote is called fertilization.
Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…
A: Aorta is the largest artery that carries oxygenated blood to rest of the heart.
Q: Many amino acid biosynthetic operon under attenuation control are also under negative control.…
A: In bacteria, transcriptional attenuation is a common means of regulating gene expression in response…
Q: A protein wilth a domain inside the hydrophobic plasma membrane and a hydrophilic domain inside of…
A: Introduction Membrane proteins:- These are common proteins that are part of, or interact with,…
Q: Lantus differs from "normal" insulin in that: Select one: Oa. The usual insulin molecule has been…
A: Glucose is the monosaccharide sugar which is a major energy source for the cells to function.…
Q: QUESTIONS FOR RESEARCH AND PROBLEMS 1. Give the major factors that cause changes in the genotype and…
A: The complete set of genetic material in an organism is known as genotype. It can also be referred to…
Q: Many modern people have some Neanderthal DNAin their genome, but the Neanderthal alleles are…
A: In the last 100,000 years, Neanderthals and contemporary humans have interbred at least twice. It is…
Q: why doesn't nalidixic acid affect human cells
A: Quinolones are one of the most commonly prescribed classes of antibacterials in the world and are…
Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…
A: The photochemical and electron transport reactions of photosynthesis process occur at the thylakoid…
Q: 10. Phagocytosis by a phagocyte is required for: B cell action b. helper T (T4) cell action c.…
A: Answer
Q: Circulatory System 1. Why are the ventricles more muscular than the atria? 2. What valve prevents…
A: CirculatorySystem: The heart, blood vessels, and blood are all part of the blood circulatory system,…
Q: If an embryo was lacking HOX genes many problems might happen including this.. neural crest would…
A: The Hox genes' function in the embryo is to specify positional uniqueness instead of the formation…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: To examine: Whether the statement "most intracellular signaling pathways provide numerous…
A: Cell signalling, also known as cell-cell communication, is responsible for directing the basic…
Q: HIV can be treated with therapy, but there is a growing in the level of innate immune activation…
A: Inanate immune system constitute first line of defense to HIV virus, paatern of association is the…
Q: 5. 5. Draw a phylogeny the following taxa: shark; tuna; frog; lizard; mouse; whale. On your…
A: Evolution solved the challenge by developing the cellular differentiation process, which resulted in…
Q: 3. In excitable cells, depolarization is most closely associated with which of the following events?…
A: INTRODUCTION A neuron is the basic functional structure of the central nervous system. Neurons are…
Q: QUESTION 12 Consanguinity most often leads to an increase in prevalence (comapred to the general…
A: autosomal recessive disorder.
Q: Endosymbiosis states that free-living [ ? ] were engulfed J of and became the [ ]of the eukaryotes…
A: Introduction :- Endosymbiosis occurs when one cell engulfs another, resulting in a coevolved…
Q: visual
A: The visual light goes through the cornea and through the iris , lens to finally makes the image on…
Q: 1. What are the major adaptations that allow nemertines to thrive in the marine environment? Support…
A: Adaptation: It is a process of evolution that allows any particular organism to be well suited for…
Q: The joining of male and female reproductive cells is called?? II. It is the make reproductive part…
A: Plants' life cycles comprise two stages called alternation of generations. The haploid gametophyte…
Q: 5. Give three economic uses of dicot stems with specific plant example.
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: high temp can decrease the deamidation reaction true or false
A: Deamination occurs mostly in the liver, but it can also happen in the kidney. Deamination is…
Q: Which of the following would be an adequate stimulus for a chemoreceptor? oxygen photon…
A: The chemoreceptors are nerve cells or receptors that sense changes in the substance composition of…
Q: The addition of monomeric units to one end of a polymer and their removal from the opposite end such…
A: Introduction The cytoskeleton of a cell is made up of intermediate filaments. actin filaments and…
Q: Given the following information about the inheritance of characteristics in pea plants, answer the…
A: 1. Different gametes produced by the female plant= yyRrBbssll Using formula = 2n n= number of…
Q: 0.0 1.0 0.0 3 0.0 0.0 1.0 4 0.5 0.25 0.25 5 0.25 0.25 0.5 0.25 0.5 0.25 7 0.33 0.33 0.33 8 0.04 0.32…
A: According to Hardy Weinberg equilibrium- p2+q2+2pq=1 Where, p= frequency of the dominant allele in…
Q: What are the functions of ovaries in a flowering plant?? A. TO PRODUCE FEMALE GAMETES B. TO PRODUCE…
A: ovary, in flowering plants is enlarged basal portion of the pistil, the female organ of a flower.
Q: In which of the following situations would you expect to probably see differences in the speed of…
A: Molecular clock It is a measure of evolutionary change over time.
Q: cance of color blindness in humans is due to a recessive gene located on the X chromosome X linked).…
A: Mother × father XXc XcY Progeny - X Xc Xc XXc…
Q: Write the characteristics of the seven taxonomic hierarchy in sentences/ paragraph and their…
A: The seven taxonomic hierarchy is.. species, Genus, Family, Order, Class, Phylum or Division and…
Q: 1. Here is how to start. You have to show the derived characteristic for each phylum (red) on top of…
A: Derived traits and Primitive traits Every individual bears some kind of characteristics specifically…
Q: Why do we use samples in the collection of d
A: Data Collection process is the collection of data in the form of samples for the proposed variables…
Q: In transcription, what is/are the importance of the sense and missense/antisense strands
A: Transcription: The process of transcribing a piece of DNA into RNA is known as transcription.…
Q: . Another mutation changes the insulin gene to read TCT (instead of the normal TA G). Will this…
A: Yes he became diabetic.
Q: How large (as a proportion of body size) should the testes of chimpanzee males be relative to…
A: The testicles are responsible for making testosterone, the essential male sex hormone, and for sperm…
Q: NUMBER OF CARBON GAS (CO2) IN THE ATMOSPHERIC AIR 1.0,03-0,04% 2. 0,07 3. 0,1 4. 0.3 5. 4,0
A: Earth's atmosphere is composed of about 78% nitrogen, 21% oxygen, and one percent other gases.
Q: 6-Before curing cycle, ideally the properly packed flask should be allowed to stand for: A-5-10…
A: ANSWER;- D) 30-60 minutes Explain;- Properly packed carafes should be allowed to stand for 30–60…
Q: To explain: Which component does the KDEL receptor bind its ligand more tightly and more weakly.
A: Proteins are the fundamental building blocks of many biological structures, including cell…
Q: In photosynthesis which percentage of oxygen produced is used for cellular respiration in the plant?…
A: The oxygen that is released in the photosynthesis is used in the cellular respiration by the plants.…
Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…
A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…
Q: Question: please provide your thoughts on whether or not melatonin seems to be a good option for…
A: Melatonin occurs naturally in both plants and mammals. Long associated with the regulation of the…
Q: In which of the following situations would you expect to probably see differences in the speed of…
A: ANSWER:- Comparison of nuclear and mitochondrial genes in the same species
Q: vascular cylinder, vascular bundle, ground tissue, epidermis , palisade mesophyll, spongy mesophyll,…
A:
Q: Explain in 3 paragraphs what is coevolution and its types (pairwise, diffuse, and genefor gene…
A: Coevolution It is defined as the process of evolution of two species in a mutually dependent…
Q: what are 4 antagonistic interaction between two or more species that are exploited to improve…
A: Antagonist interaction between two species is the negative interaction where one species is…
Q: ewith a long tailed mouse. Multiple cresses of this short-tailed mouse to long-taled mice produces…
A: Answer given in step 2 . Please find the attachment. Please provide clear image in future. Thank…
Step by step
Solved in 2 steps with 2 images
- Globular proteins with multiple disulfide bonds must be heated longer and at higher temperature to denature them. Bovinepancreatic trypsin inhibitor (BPTI), having 58 amino acids in a single chain and 3 disulfide linkages, loses its catalytic activity whenheated at nearly 90°C for 5-10 minutes. Explain the molecular basis of this observed thermal property of BPTI relative to the nativestructure and function of the protein.Non-standard amino acids are derived from common amino acids by biochemical modifications. Please identify the chiral centers of given non-standard amino acids.prpc is a normal protein of our neuronal cell membrane that is sensitive to protease action (ie can be broken down by protease) true or false?
- Globular proteins with multiple disulfide bonds must be heated longer and at higher temperature to denature them. Bovinepancreatic trypsin inhibitor (BPTI), having 58 amino acids in a single chain and 3 disulfide linkages, loses its catalytic activity whenheated at nearly 90°C for 5-10 minutes. Explain the molecular basis of this observed thermal property of BPTI relative to the nativestructure and function of the protein. do not coy from other answers heres) This is a Fish er projecti on of D-f ructose (Fisher projecti on of L-F ructose ). Dra w L-fructose. Inaddition, draw the Haworth projection of a-D fructofuranose and b-D fructofuranose, the cyclic form ofthis monosaccharide. Draw sucrose where indicated below (Haworth projection).A protein gives, under conditions of buffer composition, pH, and temperaturethat are close to physiological conditions, a molecular weight by size exclusion measurements of 140,000 g/mol. When the same protein is studiedby SDS gel electrophoresis in the absence or presence of the reducing agent β-mercaptoethanol (BME), the patterns seen, respectively, in lanes A and B are observed. Lane C contains standards of molecular weight indicated. From these data, describe the native protein, in terms of the kinds of subunits present, the stoichiometry of subunits, and the kinds of bonding(covalent, noncovalent) existing between subunits.
- The ESI-MS spectrum in positive ionization mode for lysozyme is obtained. a. What is the molecular weight of the protein to 5 significant figures based on the two highlighted ion species? b. What is the charge of the peaks at 1101.5 and 1789.2.The peptide bond on the C=O side of bulky hydrophobic residues is cleaved by a) Trypsin b) RNase H c) succinate dehydrogenase d) chymotrypsin e) Factor VIII ( explanation not needed) thank youBovine chymotrypsinogen has a molecular massof 25.6 kDa. Amino acid analysis shows that thisenzyme is 4.7% Gly (Mr 75.1).b. Calculate how many glycine residues are present in amolecule of bovine chymotrypsinogen
- Determine the sequence of the decapeptide given the following information below. The decapeptide was hydrolyzed and confirmed to contain these amino acids: E, F, K, M, Q, S, T x 3, W Edman degradation product of the decapeptide: T trypsin fragments: a tetrapeptide (F,K,Q,T) and a hexapeptide (E,M,S,2T,W) chymotrypsin fragments: free S, a dipeptide (F,T) and a heptapeptide (E,K,M,Q,T,T,W) CNBr treatment of the heptapeptide (E,K,M,Q,T,T,W) yielded a tetrapeptide (K,T,M,Q) and a tripeptide (E,T,W) Edman degradation product of (E,T,W): E Use one-letter abbreviations only. One amino acid per blank.Please state if the statements are true or false.1. An aplha 1,4 glycosidic linkage is considered a branching linkage in polysaccharides2. Isocitrate dehydrogenerase is classified as an isomerase2. Amino acid analysis of the a heptapeptide gave the following residues: Asp Glu Leu Lys Met Tyr Trp NH4+. The following facts were observed: Trypsin treatment had no effect. The phenylthiohydantoin released by Edman degradation was OH H C-C-CH₂ H. Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The tetrapeptide contained Glu, Leu, Lys and Met is some order. Cyanogen bromide treatment afforded a tetrapeptide that had a net positive charge at pH 7 and tripeptide that had a zero net charge at pH 7. What is the amino acid sequence for this heptapeptide?
