2. divin asambl ellergro .noia NisminA desione Function: In the same way... woled aldo Function: 190 Insig G In the same way... ollenspro *** Function: In the same way... Function: In the same way...

Q: Which pair shows endoparasites? a.)tick and mosquito b.)tapeworm and leech c.)leech and flea…

A:

Q: How can you tell dense regular connective tissue and smooth muscle tissue apart under the microscope

A: Introduction A group of cells organized together to perform a specific function is called a tissue.…

Q: What are the most common benign bone tumors of children?

A: Bones are the important tissues of the body which give a structural framework to the body. The long…

Q: Which of the following statements does NOT correctly describe the role of inhibin in the male…

A: Introduction :- The biological system made up of all the anatomical organs involved in sexual…

Q: What structures are affected in cleft palate and cleft lip?

A: Cleft lip and cleft palate appears as a split in the lip and roof of the mouth. This condition…

Q: In the tropical savanna, the climate is hot but with abundant water. In the Willamette Valley, the…

A: C4 plants are more efficient than C3 due to their high rate of photosynthesis and reduced rate of…

Q: 3. Give the genetic content and chromosome number (n) of a diploid cell during the following phases:…

A: Mitosis is the cell division process that involves production of two daughter cells that are…

Q: Which reflexes inhibit intestinal motility? Which promote it?

A: Reflexes are involuntary actions to certain stimuli. The intestinal reflexes are used for the…

Q: Table below presents the criteria to be used in comparing mitosis and meiosis. Provide the missing…

A: Cell division occurs in two stages: mitosis and meiosis. mitosis, the process of creating new body…

Q: identify which substrates are most compatible for L929 cell growth. Support answer with…

A: L929 is a fibroblast cell line derived from a clone of male C3H/Anmouse subcutaneous areolar and…

Q: B. Draw and label the cross section of the cat ovary (using HPO). Label all the oogenic cells. C.…

A: The organs of female reproductive organs produce female sex cells that are egg cells or ova. There…

Q: phase best describes the major process compon evolution? natural selection O adaptation O survival…

A: Ans: Charles Darwin the British naturalist gave the theory of biological evolution. He defined…

Q: How has MRSA changed musculoskeletal infections in children?

A: MRSA-related musculoskeletal infections are frequent in osteomyelitis and septic arthritis.…

Q: TRUE OR FALSE: Digestive secretions from the small intestine complete the digestion of…

A: The long, narrow and coiled part of elimentary system that starts just below the stomach, where both…

Q: is a substance secreted by cells in the lungs that reduces surface tension.

A: The alveoli are the tiny air sacs in the lungs where gas exchange happens. And there Walls are lined…

Q: Don't copy

A: We know that The blood circulatory system and lymphatic system are highly connected with each other…

Q: In dioecious plants, males usually produce larger flowers that attract more pollinators than do…

A: Answer: Dioecious plants : These are the plants which are having only either female reproductive…

Q: By what mode of cell division would you expect sperm cells to be formed in the haploid male be?…

A: Introduction: The process of sperm cell formation is called spermatogenesis. To create spermatozoa,…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: Which of the following describes the effect of the venom on the prey of the cobra?

A: Introduction Muscle contraction is a result of action potential generated by depolarization,…

Q: R8

A: We know that Hormones are defined as the type of signaling molecules that are directly secreted into…

Q: o (8) a. Which one of the following phenomena is responsible for transportation of food through…

A: Cell is the smallest functional and structural unit of life. Each cell perform their specific…

Q: Discuss the clinical manifestations of Duchenne muscular dystrophy.

A: Duchenne Muscular Dystrophy( DMD) Children may have difficulties walking or rising from a seated or…

Q: List the events occur at the neuromuscular junction.

A: Introduction The NMJ or the neuromuscular Junction is the site of synaptic connection between the…

Q: How does cellular respiration demonstrate an energy transformation? The carbon from glucose is…

A: Introduction Cellular respiration is a metabolic pathway that involves the breakdown of complex…

Q: What is the ultimate cause of variation in populations?

A: Genetic Variation in population  Genetic variation refers to differences in the genetic makeup of…

Q: The two major patterns proposed by Darwin are: 1) species change over time, and 2) species give rise…

A: Charles Darwin was a British naturalist who proposed the theory of natural selection in biological…

Q: 14. Other than bacteria list the other 6 types of Microorganisms listed in your textbook.asap

A: We know that Microorganisms are the smallest life forms on our planet. They are not visible from our…

Q: A Senecio lautus population growing on a headland has a prostate form, growing low to the ground,…

A: A Senecio lautus is a  flowering plant species in the daisy family. The two main populations of this…

Q: How can one confirm/investigate the type of inhibition exerted by azt on the hiv reverse…

A: 3'-azido-3'-deoxythymidine (AZT) is a Thymine analogue. It inhibits HIV reverse transcriptase by…

Q: What step in the scientific method follows experimentation?

A: Introduction The scientific method of research is a process that involves various steps of…

Q: Genotype frequencies from two diploid populations are estimated from a genetic marker with two…

A: Genotype frequency refers to the frequency or percentage of a particular genotype in a given…

Q: Transport proteins have been found in all biological membranes. What hypothesis could you make…

A: Transport proteins are found in the membranes of all cells and are responsible for moving molecules…

Q: Define the differences between tendons and ligaments.

A: Introduction To maintain the proper shape, structure, and integrity of the body, specialized tissue…

Q: When the mammalian brain compares the actual temperature of the body to the preferred temperature of…

A: The cerebrum, brainstem, and cerebellum make up the brain. It is in charge of the majority of the…

Q: Which of the following is not a correct description of tissue pathology? Neurilemmoma is a very…

A: Introduction: Diagnosing and characterizing neoplastic and non-neoplastic illnesses of the soft…

Q: Give two possible reasons (hypotheses) why pest control specialists experience fewer fatalities from…

A: Pest control specialists have more contact with stinging insects than the general public, but they…

Q: Compare herpes zoster and varicella.

A: Herpes zoster is just another name for shingles. The varicella-zoster virus causes both shingles…

Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: 4. Use what you know about the anatomy and physiology of special sensory organs to evaluate how each…

A: we will be discussing how different changes in an animal's anatomy and physiology can impact its…

Q: Five dialysis bags, impermeable to sucrose, were filled with various concentrations of sucrose and…

A: Five dialysis bags with varying sugar concentrations are provided. However, the bag's membrane is…

Q: Besides agarose gel electrophoresis, there is also SDS-PAGE (sodium dodecyl sulphate- polyacrylamide…

A: To separate DNA, RNA, or protein molecules according to their size and electrical charge, a…

Q: What is the difference between Becker and Duchenne muscular dystrophies?

A: Muscular dystrophies are genetic disorders. It affects the muscles and gradually destroys the…

Q: The key feature that distinguishes alternation of generations from other life cycles is O a distinct…

A: Introduction Alteration of generation is a life cycle of plants that involves two different phases…

Q: Which of the following is true about the immune system? Check all that apoply. Rejecting  organs or…

A:

Q: What would be the effect on flowering time of over-expressing VIN3 (i.e., 35S:VIN3) in a winter…

A:

Q: How do the skin blood vessels and sweat glands regulate body temperature?

A: The skin blood vessels regulate body temperature by- During hot climate or when the heat is more…

Q: Describe the two layers of the skin.

A: Skin is the largest external organ of our body that forms a external protective layer and protects…

Q: Supposed mitotic and meiotic  had never evolve. What do you think would have been the consequences?…

A: Mitosis and meiosis are cell division proces. Mitosis results in cloned cells while meiosis makes…

Q: How could control of the glow trait be ultimately determined?

A: Introduction Genes are the hereditary units present on the chromosomes, these genes encode specific…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.