2. For this diagram of transcription and translation in a bacterial cell - help explain the process by Identify which part is transcription and which is translation Label the 5' and 3' ends on the mRNA and DNA. a. b. C. Label the arrow with either the N (amino) termini of the protein being made or the C (carboxyl) termini of the protein being made. d. Label the template strand for transcription. e. On the DNA, box the three bases encoding the first amino acid of the protein being made. Box the approximate location on the RNA as well. f. Identify the part of the diagram where tRNAs would bind. 5 3' RNA Polymerase GGGCATGCGCCCTAC CCCGTACGCGGGA mRNA ribosome GGCATAAAGCTCCCCAGTTTGCGCGCGCATTGTGATG TGCCGTATTTCGAGGGO AAACGCGCGCGTAACACTAC Promoter

2. For this diagram of transcription and translation in a bacterial cell - help explain the process by Identify which part is transcription and which is translation Label the 5' and 3' ends on the mRNA and DNA. a. b. C. Label the arrow with either the N (amino) termini of the protein being made or the C (carboxyl) termini of the protein being made. d. Label the template strand for transcription. e. On the DNA, box the three bases encoding the first amino acid of the protein being made. Box the approximate location on the RNA as well. f. Identify the part of the diagram where tRNAs would bind. 5 3' RNA Polymerase GGGCATGCGCCCTAC CCCGTACGCGGGA mRNA ribosome GGCATAAAGCTCCCCAGTTTGCGCGCGCATTGTGATG TGCCGTATTTCGAGGGO AAACGCGCGCGTAACACTAC Promoter

Name: 2. For this diagram of transcription and translation in a bacterial c
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 2. For this diagram of transcription and translation in a bacterial cell - help explain the process by....Identify which part is transcription and which is translationLabel the 5' and 3' ends on the mRNA and DNA.Label the arrow with either the N (am

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 6TYK

See similar textbooks

Similar questions

1.- Outline the general process of transcription (dna->rna) include a diagram a) include the basic enzymes involved and a description of their actions b) what is the product of transcription c)what will the cell do with the product d)where does the transcription take place in prokaryotic cell
1.A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine 2. Active transcription does not occur in regions of chromatin loops that are located ________. Group of answer choices a. A large distance away from the MARS b. Within the euchromatin c. Near the MARS d. A large distance from the telomere 3. Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent mutation? Group of answer choices a. 5′-AUG GUU AGA GUU GAA AAA-3′ b. 5′-AUG GCU UGA GUU GAA AAA-3′ c. 5′-AUG GCU AGA GUU GGA AAA-3′ d. 5′-AUG GCU CGA GUU GAA AAA-3′
4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)
1. Why aren't ssb proteins necessary in transcription?
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
A binding .site for RNA polymerase is called a ___ . a. gene b. promoter c. codon d. protein
3. What are the components of the initiation complex for translation
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
1. Write a short note on transcription. What is TFBS? What is the role of RNA polymerase?2. What do you understand by cis & trans regulations? Describe. Answer all the part in detail...