2. Use the plasmid to answer the following questions: [6T] a) Digest the plasmid with EcoRI only and then both EcoRI and BamHi together. Fill in the table to show the fragment sizes produced. [3] EcoRI only EcoRI and BamHI together Fragmen t sizes produced EcoRI b) In the space below, sketch the gel that would be produced by these two digestions to show how the fragments would separate. (Write the fragment length beside each of the bands on the gel). [3] BamHI 5050 bp BamHI 0/6400 bp 3100 bp 830 bp EcoRI

2. Use the plasmid to answer the following questions: [6T] a) Digest the plasmid with EcoRI only and then both EcoRI and BamHi together. Fill in the table to show the fragment sizes produced. [3] EcoRI only EcoRI and BamHI together Fragmen t sizes produced EcoRI b) In the space below, sketch the gel that would be produced by these two digestions to show how the fragments would separate. (Write the fragment length beside each of the bands on the gel). [3] BamHI 5050 bp BamHI 0/6400 bp 3100 bp 830 bp EcoRI

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter17: Bacterial And Viral Genetics

Section: Chapter Questions

Problem 5TYK

See similar textbooks

Similar questions

1. Write if the statement is true and modify the statement with the correct answer if its false a.White colonies represent those bacteria that do not express the genes for beta-galactosidase because restriction enzymes have cut the gene and ligase have not repaired the break b.Antibiotic resistance genes in bacterial transformation are used as marker genes because of ease of detection of transformants. c. Bacterial transformation simply means the insertion of a recombinant plasmid into a bacterial cell.
1 (a) What do ApR, TcR, and ori on the pBR322 map represent and discuss there individual functions? (b)Does the undigested plasmid show more than a single band when electrophoresed? Why? (c)What other kinds of molecules, in addition to plasmid DNA would you expect to find in a sample of plasmid DNA extraction? (This is not a graded assignment)
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
3. Another common electrophoresis buffer is TBE. How does this buffer differ from TAE? (plasmid purification experiment)
9. Estimate the sizes of the bands, in each of the lanes for the gel attached below. Then, for each lane, match the fragments created with the set of restriction enzymes used in the digestion of 640 bp DNA.
2. List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
1. Describe a certain species to use to for recombiant plasmids and explain what recombinant plasmids will do?
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
1. If you do an absorbance reading after plasmid purification and get a A260/A280 of less than 1.8, how could you further purify the sample to get rid of the protein contamination? Is it always necessary to have completely pure DNA? What are some cases where it would or would not be?
7) Why are the following reagents used? Neutralizing solution (Plasmid isolation) Isopropanol (Plasmid isolation) RNase (isolation of genomic DNA)
Use the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. What is the smallest fragment size that the NcoI/EcoRI double digest produces?