2.How does hydrochloric acid aid in the digestion of food? Read and analyze the question and choices CAREFULLY; more importantly, ALWAYS CHOOSE the BEST answer. Hydrochloric acid initiates carbohydrate and protein digestion in the stomach. Hydrochloric acid is the gastric juice that stops lipid digestion in the stomach. Hydrochloric acid does not really participate in the digestion of food; however, the acidic environment due to HCl activates pepsinogen which will be converted into pepsin that breaks down peptide bond between amino acids in a polypeptide. Hydrochloric acid breaks down the peptide bonds, glycosidic bonds, and acid anhydride bonds among proteins, carbohydrates, and lipids respectively.

Q: Icefish live in the extremely c They are the only vertebrates bin. They have a large heart a their…

A: A new study has discovered a concerning link between warmer seas, declining sea ice levels, and…

Q: What advantage does the retrovirus that causes AIDS have comparedto an RNA virus?

A: HIV is a retrovirus categorized as enveloped virus containing a single-stranded, positive-sense RNA…

Q: Unhealthy diet problem Possible Solutions (List of Different Solutions) What are the possible…

A: Nutrients are the compounds found in food that give us energy, allowing us to heal and develop,…

Q: The closest living relatives of hagfishes are_____ . a. snakes c. lampreys b. sharks d. placoderms

A: The organisms that has a common ancestor can share a relativity of closeness among it. These…

Q: You have a mouse model that is a homozygous knockout mutant for the prnp gene (Prnp protein is not…

A: knockout mouse is a genetically engineered laboratory mouse (Mus musculus) in which a specific gene…

Q: . differential lengths of poly-A tails affect mRNA stability a. pre-transcriptional control b.…

A: In the cytoplasm, the poly(A) tail interacts with the 5′ end of mRNA via eIF-4G, which binds both…

Q: Please answer the following 35 MCQS Pinocytosis is cell eating cell drinking cell lysis O cell…

A: Introduction :- Pinocytosis is a cell's process of ingesting fluids as well as dissolved small…

Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…

A: Twins are two offspring produced by same mother in same pregnancy.  Twins can be identical and non…

Q: What kinds of molecules the cell membrane witho transport proteins? O Large and hydrophobic= O Small…

A: Cell membranes act as barriers and gatekeepers. Cell membrane is semi-permeable .Cell membrane…

Q: Think about Clostridium botulinum. Explain the terms below that describe this a. Gram-positive b.…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: In order for the Golgi apparatus to release synthesized molecules to the outside of the cell…

A: The proteins synthesis in the cytosol or RER membrane need to be translocated to their respective…

Q: Calibri Light (H.. v 11 A BIU ov Av A 2. Are bacteria unit- or multicellular? What about the chains…

A: Since you've asked multiple questions, we are only answering the first three answers for you. If you…

Q: Trace the evolutionary origin of viruses according to current hypotheses and describe research…

A: A virus is an infectious agent that multiplies within the host body. A virus is made up of three…

Q: _______function(s) in the movement of cnidarians. a. A hydrostatic skeleton c. Cnidocytes b. Tube…

A: Phylum cnidarian is coelenterates that lack the body coelom (acoelomate). They are marine animals…

Q: Immunohistochemistry is routinely used to determine specificity and identification of disease.…

A: Immunohistochemistry is a immunostaining process in which antigens in the cells are identified by…

Q: oxytocin gene due to methylation. II. Mice with hypermethylation of the agouti gene became obese and…

A: Membrane fracturing, physical or pharmacological opening of the cervix, and oxytocin injection,…

Q: 4. In cattle, polled (absence of horns) is dominant over horned and roan is the result of the…

A: Let us consider, H is the polled allele (hornless) and h is the allele that represents presence of…

Q: Which figure represents the non- competitively inhibited enzyme? Figure 1 Suhatrate Product Enzyme O…

A: Enzymes are essential components of all metabolic processes in the body. They are catalytic…

Q: Why is solely cutting calories not as efficient as cutting calories and exercise? O Reduced resting…

A: Diet and exercise are both important for optimal health. Achieving a calorie deficit through diet…

Q: EXTRANUCLEAR INHERITANCE A maternal effect gene exists in a dominant N (normal) allele and a…

A: The maternal-effect occurs due to the inheritance of the factors/genes present in the cytoplasm. The…

Q: Write the word TRUE if the statement is correct; if not, write the WORD that makes it false.…

A: Under typical environmental conditions, biodegradation is the decomposition of materials into…

Q: The science of producing and transmitting sound waves in materials has become widespread with many…

A: The ultrasonic waves have good propagation in the human body. Thus, it have been widely applied in…

Q: Which of the following enzymes has the highest functional error?  a) DNA Polymerase I b) DNA…

A:

Q: Describe the anatomical and physiological adaptations that aroseduring the transition to life on…

A: Life evolved underwater so the earth was totally covered with water at the beginning of humankind,…

Q: eukaryote cell typically has enough available ATP to meet its needs for about 90 seconds. What would…

A: Eukaryotes are life forms whose cells contain a nucleus and other membrane bound organelles. There…

Q: Discuss the operation of Na+ - K+ pump in further detail (2 pages including a few figures, if…

A: * The sodium potassium pump can be found in many cell plasma membranes which can be Powered by ATP…

Q: The embryo of monocotyledonous seed consists of one large, shield shaped cotyledon. What is it known…

A: Embryo of monocot Though the seeds differ greatly, the early stages of embryo development…

Q: Discuss the following statement: “We wouldhave no idea today of the importance of insulin as a…

A: Introduction Insulin aids the entry of blood sugar into the body's cells, allowing it to be utilised…

Q: Almost all of the known species of the taxa Archea have been identified through cultivation in a…

A: The culturable as well as organisms of archae that are well investigated belongs to the species of…

Q: Earthworms are most closely related to________ . a. tapeworms c. planarians b. roundworms d. leeches

A:

Q: Which figure represent the lock and key model? Substrate Figure 1 Figure 1 Figure 2 Figure 3 Enzyme…

A: Introduction :  lock and key model denoted the enzyme substrate interaction . Each Enzyme has a…

Q: Nondisjunction can happen in males and females. It has been found to correlate with advanced…

A: Non disjunction is the failure of chromosome separation during meiosis that cause to produce…

Q: 1. Briefly describe the affect of the glutamic acid to valine mutation on the Hemoglobin protein as…

A: Answer

Q: Question 23 Where is the ATP primarily made in a plant cell? O stroma and mitochondrial…

A: Introduction A plant cell is a eukaryotic cell that contain a distinct nucleus and certain…

Q: Breakdown the Science of the Vitamin K. • Structure • Function • Purpose .

A: Introduction Vitamin K is a family of fat-soluble vitamins that aid in blood clotting, bone…

Q: You have just gotten back the results from an RNA-seq analysis of mRNAs from liver. You had…

A: RNA-Seq which is expanded as RNA sequencing is described as a sequencing technique that makes use of…

Q: During 24 months, a population of 5,000 prairie dogs experienced 6 500 births and 5 560 deaths.…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Enzyme linked receptors: Function directly as enzymes or they are linked to enzymes O Are surface…

A: Enzyme linked receptors are also known as catalytic receptors, and it is a integral membrane protein…

Q: 24.2 The Life Cycle of a Flowering Plant 7. The photo is a cross section of a (an). The numerous…

A: Pollen grains are the male gametophyte of a flowering plant. These develop from microspores, which…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.

Q: How would you expect the development of each of the following to occur in male rats were given an…

A: Aromatase inhibitor is the class of molecules/compounds that interfere with the aromatase enzyme and…

Q: Which tissue type or organ is correctly matched with its germ layer tissue? A) nervous–mesoderm B)…

A: Introduction :- The mesoderm is a germ layer that develops between the ectoderm, which produces skin…

Q: 13. A silent mutation A) does not change the protein that is produced. B) has a very minor change on…

A: In our existing nature, the mutation is very dynamic and it subjects to various types of heritable…

Q: In which figure (s), the type of inhibition is reversible? Substrate Figure 1 O Figure 1 O Figure 2…

A: The active site of the enzyme is the site where the specific substrate can bind according to the…

Q: Plant anatomy

A: The embryo develops at the micropylar end of the embryo sac where the zygote is situated. Most…

Q: Describe the traits common to all fishes.

A: Fishes are diverse. They have evolved to live successfully in underwater environment, from streams…

Q: during development, all cells have different genotypes and gene regulation allows different…

A: ANSWER;- true

Q: How has “success” been defined? Where would the success be manifested—in individuals, in…

A: Success is defined as achievement of a desired outcome in an acceptable manner.

Q: The mouse REST gene is under the control of a promoter region which contains alternative promoters.…

A: Ribosomes perform an important function in protein biosynthesis in the cytoplasm. The mRNAs that are…

Q: Explain how snakes are related to lizards

A: Snakes and lizards are closely related to each other that belongs tothe order squamata of the…