(D) some DNA molecules may sink to the bottom and not migrate(E) some DNA molecules may eross-link20. The procedures described can be used to do all of the following EXCEPT(A) isolate and purify certain DNA fragments(B) synthesize novel DNA molecules(C) study the activity of restriction enzymes(D) calculate the size of DNA fragments(E) identify the source of DNA materialQuestions 21-23A culture of white-eyed fruit flies (Drosophila melanogaster) was maintained for manygenerations. Females from the stock white-eyed culture were crossed with red-eyed(wild-type) males. The F1 females were crossed with the white-eyed males from theoriginal culture. The resulting phenotypes of the progeny are summarized below.Parental Generation CrossF1 Generation (at least 500 flies)100% of females are red-eyed100% of males are white-eyedWhite-eyed females x red-eyed malesF1 Generation CrossF2 Generation (at least 500 flies)Fl red-eyed females x white-eyed males 50% of females are red-eyed and 50% are white-eyed50% of males are red-eyed and 50% are white-eyed21. The best explanation for the red-eyed F1 females is(A) mutation(B) culture contamination(C) dominance(D) multiple loci(E) sex-influenced traits22. There are white-eyed females in the F2 generation because(A) white is a dominant allele(B) the white allele is autosomal(C) a mutation has occurred(D) these F2 females have two white alleles(E) the white allele is located on the Y chromosome23. Which of the following best describes the mode of inheritance of eye color in the whiteculture?(A) Autosomal(B) Dominant(C) Located on the Y chromosome(D) Sex-linked(E) Lethal24. Assume that genes A and B are not linked. If the probability of allele A in a gamete is 1/2and the probability of allele B in a gamete is 1/2, then the probability that both A and Bare in the same gamete is(A) 1/2 x 1/2(B) 1/2 + 1/2(C) 1/2 1/2(D) 1/2(E) 1/2 x 1/225. A couple has 5 children, all sons. If the woman gives birth to a sixth child, what is theprobability that the sixth child will be a son?(A) 5/6(В) 1/2(С) 1/5(D) 1/6(E) 1/64

A culture of white-eyed fruit flies (Drosophila melanogaster) was maintained for many generations.…

21. The best explanation for the red-eyed F1 females is (A) mutation (B) culture contamination (C) dominance (D) multiple loci (E) sex-influenced traits 22. There are white-eyed females in the F2 generation because (A) white is a dominant allele (B) the white allele is autosomal (C) a mutation has occurred (D) these F2 females have two white alleles (E) the white allele is located on the Y chromosome 23. Which of the following best describes the mode of inheritance of eye color in the white culture? (A) Autosomal (B) Dominant (C) Located on the Y chromosome (D) Sex-linked (E) Lethal

21. The best explanation for the red-eyed F1 females is (A) mutation (B) culture contamination (C) dominance (D) multiple loci (E) sex-influenced traits 22. There are white-eyed females in the F2 generation because (A) white is a dominant allele (B) the white allele is autosomal (C) a mutation has occurred (D) these F2 females have two white alleles (E) the white allele is located on the Y chromosome 23. Which of the following best describes the mode of inheritance of eye color in the white culture? (A) Autosomal (B) Dominant (C) Located on the Y chromosome (D) Sex-linked (E) Lethal

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

During electrophoresis, DNA molecules can easily be separatedaccording to size because all DNA molecules have the samecharge–mass ratio and the same shape (long rod). Would youexpect RNA molecules to behave in the same manner as DNAduring electrophoresis? Why or why not?
Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in mm?
Meselson and Stahl grew bacteria in medium containing heavy nitrogen. After many celldivisions, the bacteria were removed, washed and allowed to continue growth in mediumcontaining normal (light) nitrogen.a. In this experiment, what part of the DNA gets labeled with heavy nitrogen?
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
Which DNA fragment, A, B, C, D, E, or F, is the largest?Which two DNA fragments are the same size? Select all that apply. Which DNA fragment, B, C, D, or E is about the same size as the lengths of the fragment A and fragment F added together?
Imagine you have three test tubes containing identicalsolutions of purified, double-stranded human DNA.You expose the DNA in tube 1 to an agent that breaksthe sugar-phosphate (phosphodiester) bonds. Youexpose the DNA in tube 2 to an agent that breaks thebonds that attach the bases to the sugars. You exposethe DNA in tube 3 to an agent that breaks the hydrogen bonds. After treatment, how would the structuresof the molecules in the three tubes differ?
If the GAATTC palindrome repeats are randomly found along the DNA strand, then what can you say about the sizes of the fragments that will be produced when the DNA is digested with a restriction enzyme that recognizes that sequence? How does the total length of the fragments relate to the size of the original DNA fragment?
How many nanograms of DNA should we expect to be contained within the slowest band from the HinDIII-digest of pGLO?
For each of the restriction enzymes listed below:(i) Approximately how many restriction fragmentswould result from digestion of the human genome(3 × 109bases) with the enzyme? (ii) Estimate theaverage size of the pieces of the human genomeproduced by digestion with the enzyme. (iii) Statewhether the fragments of human DNA produced bydigestion with the given restriction enzyme wouldhave sticky ends with a 5′ overhang, sticky endswith a 3′ overhang, or blunt ends. (iv) If the enzymeproduces sticky ends, would all the overhangs on allthe ends produced on all fragments of the humangenome with that enzyme be identical, or not? (Therecognition sequence on one strand for each enzymeis given in parentheses, with the 5′ end written atthe left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage.)a. Sau3A (^GATC)b. BamHI (G^GATCC)c. HpaII (C^CGG)d. SphI (GCATG^C)e. NaeI (GCC^GGC)f. BanI (G^GYRCC)g. BstYI…
When a segment of DNA containing either aVNTR or an RFLP is analyzed, the result is fragments of DNA ofdifferent lengths. How, then, are VNTRs and RFLPs different?
1. How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is SYBR green less toxic than EtBr? 3. What are the similarities and differences between Manual and Automated Sanger Sequencing? 4. What is the relationship between DNA fragment length and the distance it will run in a gel? (Restriction Enzyme Digestion)