5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG   CCCAGGATAATTGCGTG 5’   Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer

Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…

A: the coding strand is given in the question which will replicate to form a template strand. Then…

Q: 5'-AAAAACCCCCGGGGGTTTTT-3' is in a test tube. What else needs to go in the test tube to so that we…

A: Here it is not mentioned that how the single stranded DNA is maintained. As the single strand…

Q: Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…

A: (A) No. Of base pairs in the bacterium continue Some important Data-- Molecular weight of one base…

Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…

A: DNA polymer:   3'- CAG TTA AGG CTC CTA GGT TA - 5'   a) first 5 bases at the 3' end of the…

Q: Remember when looking up a codon make sure it is in its mRNA form.   Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four…

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic sequence in the…

Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…

A: The genetic material in most organism is double stranded DNA with the two strands running in…

Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: Determine the characteristics of this piece of double-stranded DNA.   GTCTTTTACTTGAAT…

A: DNA is the double helical structure that contains the information that help in inheritance. The…

Q: Fig 3.16 EcoRI SacI Kpnl ampR Aval Xmal Smal lacZ BamHI Xbal Sall AccI HincII PstI Sphl HindIII Bam…

A: A bacterial protein termed restriction enzyme, also known as molecular scissors, cleaves DNA at…

Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…

A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…

Q: 1. Complete the structure of this section of a DNA molecule. Label each base (A.I,G,C), sugar (S)…

A:

Q: Draw the structure of the double Holliday junctionthat would result from strand invasion by both…

A: Holiday junction are intermediates of homologous recombination and this junction formation occur…

Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…

A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…

Q: iven the structures of the nitrogenous bases below, draw the structure of a part of DNA with the…

A: The hereditary substance present in the cell is known as the genetic material. DNA acts as the…

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: 2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide…

A: Great Biologist, Francis Crick proposed the Central Dogma in the molecular biology, which states the…

Q: 4b) Chargaff was the first person to isolate large strands of genomic DNA, rather than small…

A: DNA is the hereditary material in humans and almost all other organisms. Nearly every cell in a…

Q: Which statement below explains the trick in sanger sequencing that produces fluorescently labeled…

A: DNA sequencing  Sequencing of DNA is a method to know the order of nucleotide bases in a DNA strand.

Q: 25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are the DNA digesting enzymes.

Q: 90. The DNA template fragment shown was sequenced by the Sanger method. A sample of the DNA was…

A:

Q: FIGURE 19.16 Direct repair of dam- aged bases in DNA. (a) The repair of thymine dimers by…

A: The DNA (deoxyribonucleic acid) is the hereditary unit. It is a double stranded structure of…

Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…

A: First a coding strand forms its complementary template strand during replication. Then m RNA is…

Q: Which of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains…

A: The genetic material in most living organisms is present in the form of deoxyribonucleic acids…

Q: if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the…

A: DNA or Deoxyribonucleic acid is the genetic material which passes from one generation to another.…

Q: Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’   A. How…

A: A nucleotide consists of a sugar, a nitrogenous base and a phosphate group. A phosphodiester bond is…

Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…

A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…

Q: pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA…

A: DNA (deoxyribonucleic acid), as well as RNA (ribonucleic acid) both, are the genetic material in the…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to…

A: Some enzymes are called endonucleases cleave the phosphodiester bonds that exist in the DNA. Some…

Q: Basisse triplet nommer/ Base triplet number  1  2  3  4  5  6  7  Menslike DNA-volgorde /…

A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…

Q: 2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide…

A: As per honor code, we only answer one question at a time, therefore, we are answering the first…

Q: 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ?…

A: Nucleosides contain only sugar and a base whereas Nucleotides contain sugar, base, and a phosphate…

Q: As shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at…

A: E.coli. is a key model organism and has been used in so many research studies involving molecular…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…

Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…

A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…

Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…

A: Protein synthesis from a gene consists in eukaryotes consist of three major steps: Transcription: It…

Q: 25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are molecular scissors that are used in recombinant DNA technology to cut DNA at…

Q: Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG  is TACTAATAGGATATC.

Q: 18 Fred Sanger developed an effective DNA sequencing technique in 1977. Thepeed at which DNA can be…

A: Fred Sanger developed DNA sequencing technique in 1977.  DNA sequencing is based on the base pairs…

Q: 34.  Give the sequence of the complementary DNA strand of the DNA chain with the following base…

A: Complementarity refers to the lock-and-key relationship between two structures. Complementarity is a…

Q: A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is…

A: The given ssDNA would serve as a template strand for the synthesis of a complementary strand to form…

Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…

A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine…

A: Chromosome is a storehouse of genetic information. Each chromosome is made up of DNA (…

Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…

A: Answer is option 1 Explained in paper pen format in step 2

Q: 5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3' 31-TTCGCCCACACTCCTCGCGCCGT…

A:

Q: Describe the three-dimensional structure of DNA. 2. What is DNA denaturation?

A: a. DNA is a double-helical structure that carries the genetic information for the growth,…

Q: 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene…

A:

Q: 1) The nitrogenous bases content of a sample of DNA was found to be 3.2% adenine. Determine the…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…