3. You are surveying an area's rock layers using absolute dating. You have an element whose half-life is 5 000 years. You noticed that only 1/2 of the original amount is left in the rock layer. How old is the rock laver?

Q: Consider the following statements and indicate whether each presents an idea of Jean-Baptiste…

A: The evolution is the change in the characteristics of a species over several generations. It mainly…

Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI. Be sure to…

A: Answer

Q: Helping tags: Biology, microbiology, food microbiology, lactic acid bacteria, fermentation 1. You…

A: A starter culture is a type of microorganism or consortium of microorganism that initiates the…

Q: Test Metabolic process indicated by a positive test. Citrate Indole Catalase Urease Methyl Red/…

A: Citrate test- are used to detect the use of citrate by an organism.  Indole- it differentiates the…

Q: a thymine dimer formed after UV radiation would be best described as a base substitution a base…

A: Mutation is the change in DNA sequence. Mutations can occur due to exposure to ionising radiation or…

Q: My Diagnosis for Patient C Sex: Chromosomal Disorder: Justification:

A: Karyotype can be defined as a numbers ;size and shape of metaphase  chromosomes.It involves the…

Q: What are the concepts behind osmosis and enzymatic browning in potatoes?

A: Osmosis is the movement of water or other solvents across a semi permeable membrane from a region of…

Q: What is the other pathway of antigen processing? What is the advantage of having two distinct…

A: Antigen processing, also known as the cytosolic pathway, is an immune mechanism which prepares…

Q: One type of epithelial tissue can convert into another under certain abnormal conditions. Give two…

A: Introduction :- The epithelium is a type of body tissue that forms the covering on all of your…

Q: 1. What is the area (in cm^2) of a small square in hemacytometer?

A:

Q: 14 15 16 8 10 12 6. 13 17 10 11 Male Female

A: Male :  * 1 is kidney * 2  is renal vein * 3 is ureter  * 4 is renal artery * 5 is testis  * 6 is…

Q: 5. fibers are strong but flexible and recoil. 6. The fluid connective tissues are and 7. The main…

A: Tissue: The Tissue is a group of cells that have similar structure and that function together as a…

Q: Outline the events in the innate and adaptive immune responses, from when a pathogen invades to…

A: Introduction  Immunity: it is the property/capability of our system to fight against the harmful…

Q: PROCEDURE 1 Time to Trace! In this procedure, you will be tracing two invaders: bacteria in the…

A: Bacteria are microscopic, single-celled organisms that exist in their millions, in every…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: Please make a conclusion for this, thank you so much! :) An ear of corn has a total of 381 grains,…

A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is…

Q: Temperature-dependent sex determination (TSD) is the method of sex determination in sea turtles. In…

A: The answer to this question is solved in serial wise. A) Cellular Events

Q: Why is mutation important to evolution if it is the microevolutionary force that generally has the…

A: Microevolution is the evolution that acts on a small population or in a single species and it is…

Q: answer each part with increase or decrease

A: The term amino acid is short for α-amino [alpha-amino] carboxylic acid. Each molecule contains a…

Q: What is the final electron acceptor for aerobic organisms?  What does this mean?

A: Aerobic respiration needs oxygen. It is the release of large amount of energy in cells by breakdown…

Q: Asymmetric cell division often relies on cytoskeletal elements to generate or maintain the…

A: Introduction A parent cell divides into two or more daughter cells in the process of cell division.…

Q: What is the purpose of the central canal? O houses blood vessels and nerves O houses adipose tissue…

A: The central canal of the spinal cord houses cerebrospinal fluid that nourishes the spinal cord. Here…

Q: Distinguish between pure and applied science

A: Science can be defined as the study and comprehension of the natural and social worlds through a…

Q: schema __ illustrates simple segragation. shema__illustrates how interpersion is violated during…

A: * Different designs of tank arrays modified and redrawn from ocean acidification . * Different…

Q: discuss , the relationship between cell viability and cell vitality and cell apoptosis as suggested…

A: * Cell viability is ratio of initial cell number to ratio of dead cell number  * A viability assay…

Q: Why has the American medical profession risen to itspresent heights?

A: Medical profession is field which provides health care services to patient.like pharmacy, hospital,…

Q: How many x chromosomes are present in a male skin cell during metaphase?

A: Introduction:- In humans, the X chromosome is one of two sex chromosomes (the other is the Y…

Q: Enzymes are catalytic proteins or RNA molecules that accelerate chemical reactions. Substrates  are…

A: * Enzymes are proteins speed up chemical reactions by binding to substrate. *Enzymes are also…

Q: 5. Describe a density-independent factor and explain why its effect on population growth is…

A: Food or nutrient shortages, environmental pollutants, and climate extremes, such as monsoons, are…

Q: O Variolation had high infectious (10%) and death rates (up to 3%). Vaccination was much safer and…

A: INTRODUCTION  Variolation was an old method used for immunize infected persons against some deadly…

Q: 1 pts List the following events in order as they would occur inside a skeletal muscle fiber: 1)…

A: The signals of contraction of muscles are carried by the nerves at the neuromuscular junction…

Q: The localization of Ase1 and the phenotype of its deletion imply that this protein binds to…

A: During the cell division, the Spindle which is formed helps in driving the separation of the sister…

Q: State any five objectives of biological classification.

A: Introduction In this question we will discuss about the objectives of biological classification.

Q: How can researchers test the hypothesis that clinal variation among populations of a particular…

A: A gene is a functional unit on a chromosome that is passed down from parents to offspring in order…

Q: Sir Robert, a 42-year-old male, returned to his home in England after an adventure along the Nile…

A: * Given that sir Robert went for adventure in Nile delta and after returning home he experienced…

Q: HAZARD AND VULNERABILITY IDENTIFICATION AND ASSESSMENT OF MINING AFFECTING RIVER

A: Water pollution is the polluting of streams, rivers, lakes, seas, or groundwater by pollutants…

Q: Ammonia concentrations are very low. Using structural formulac, diagram vert one molecule of…

A: Introduction Ammonia production occurs in all tissues of the body during the metabolism of a variety…

Q: describe the process of lysosomal hydrolase arriving to the lysosome. without including translation

A: The targetting of lysosomal enzyme depends on GERL system. Lysosome, Golgi bodies, endoplasmic…

Q: What is the difference between REGULATORY VS SUBSTRATE DEPENDENT PATHWAYs. consider WT, single…

A: There are two types of paths available. Regulatory routes and assembly or metabolic processes have…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: The guinea pig, also known as the domestic guinea pig, is a rodent species in the Caviidae family.…

Q: 21. Which macromolecules always contain carbon, hydrogen, oxygen, nitrogen, and sulfur? A. nucleic…

A: Introduction:- Any exceedingly big molecule with a diameter ranging from roughly(105 to 103 mm) is…

Q: A two-month-old baby is found to lack class I MHC molecules. How would this defect impact his…

A: A large locus present on vertebrate DNA known as the Major Histocompatibility Complex (MHC), has a…

Q: What important biological characteristics of life depend on mitotic cell division?

A: Cell division is a process that results in the development of two daughter cells is named Mitosis.…

Q: b. What is the average charge of the amino acid at a pH of 10? Please round your answer to the…

A: The isoelectric point is the point at which amino acids carry no net charge.

Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…

A: Asexual and/or sexual reproduction are used by animals to make offspring. Both systems have benefits…

Q: If there is a certain trait that you want animals or humans to possess, what is it? To what organism…

A: The desired trait can be anything in regards to the desired charecteristic to be reflected in human…

Q: Insects are ectothermic and the respiratory rate is usually proportional to the temperature of the…

A: TROPICS:- Insects adapt in the tropics by undergoing anatomical modifications. Example can be the…

Q: Describe the most significant hormones responsible for sex differentiation. List the most important…

A:

Q: What is the common ground between evolutionary biologists and developmental biologists who have…

A: Evo-Devo is well stated that they are been sued as the abbreviation for evolutionary developmental…

Q: Explain the process of genome editing ?

A: Introduction:- The genome is a cell's complete set of genetic instructions. The genome of humans is…