3). You mutagenize bacteria, plate them to the permissive temperature, then replica plate to the restrictive temperature. After lots of replica plating and mapping, you find mutants in dnaB. a). What is the phenotype of these mutants at permissive and non-permissive temperatures? Focus on the macroscopic phenotype (what happens at the level of cells) and not the molecular phenotype (which step in replication is compromised). b). Can you make constitutive mutants (the mutation is always active) in dnaB? Why or why not?

3). You mutagenize bacteria, plate them to the permissive temperature, then replica plate to the restrictive temperature. After lots of replica plating and mapping, you find mutants in dnaB. a). What is the phenotype of these mutants at permissive and non-permissive temperatures? Focus on the macroscopic phenotype (what happens at the level of cells) and not the molecular phenotype (which step in replication is compromised). b). Can you make constitutive mutants (the mutation is always active) in dnaB? Why or why not?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

A single DNA molecule contains two specific target sites separated by an intervening sequence. If site-specific recombination between these sites causes the intervening sequence to be released as a separate circular DNA molecule containing one target site, then the sites were oriented in A) opposite directions causing excision. B) the same direction causing excision. C) opposite directions causing integration. D) the same direction causing integration. E) the same direction causing inversion.
A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally, with both BamHI and HpaII together. Fragments of the following sizes are obtained from these reactions: BamHI: 20-kb, 6-kb, and 4-kb fragments HpaII: 21-kb and 9-kb fragments BamHI and HpaII: 20-kb, 5-kb, 4-kb, and 1-kb fragments Draw a restriction map of the 30-kb piece of DNA, indicating the locations of the BamHI and HpaII restriction sites.
When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…
A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally, with both BamHI and HpaII together. Fragments of the following sizes were obtained from this reaction: BamHI: 20-kb, 6-kb, and 4-kb fragments Hpall: 21-kb and 9-kb fragments BamHI and Hpall: 20-kb, 5-kb, 4-kb, and 1-kb fragments Draw a restriction map of the 30-kb piece of DNA, indicating the locations of the BamHI and HpaII restriction sites
A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp
a. What is the purpose of molecular cloning?b. What purpose do selectable markers serve in vectors?c. What is the purpose of the origin of replication in aplasmid vector?d. Why do cloning vectors have polylinkers?
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
Consider the ends of the DNA fragments shown below. They have been produced by digestion of a single sequence of DNA using a number of restriction endonucleases. 1. 5'A 3' 3'TTCGA5' 2. 5'G 3' 3'CAGCT5' 3. 5'AATTC3' 3' G5 4. 5'TCGAC3' 3' G5' 5. 5'GGG 3' 3'CCC 5' Which of these ends are capable of annealing and being joined by DNA ligase?
If you wanted to create recombinant DNA using this enzyme(3' T A 5'), would you have to cut both samples of DNA with this enzyme, or could you use two different restriction enzymes? Explain.
In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA polymerase I. The lagging strand contains three Okazaki fragments. The RNA primers have not yet been removed. A. Which Okazaki fragment was made first, the one on the left or the one on the right? B. Which RNA primer will be the first one to be removed by DNA polymerase I, the primer on the left or the primer on the right? For this primer to be removed by DNA polymerase I and for the gap to be filled in, is it necessary for the Okazaki fragment in the middle to have already been synthesized? Explain. C. Let’s consider how DNA ligase connects the left Okazaki fragment with the middle Okazaki fragment. After DNA polymerase I removes the middle RNA primer and fills in the gap with DNA, where does DNA ligase function? See the arrows on either side of the middle RNA primer. Is ligase needed at the left arrow, at the right arrow, or both?
Ehat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatg
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.