4.) Below is a replication fork. This is half of a replication bubble. 3' 3' a. Draw a circle to indicate the location of the helicase and an arrow to show the direction it is moving. b. On each DNA template, draw just one RNA primer (short, thick line) and the new DNA (longer). Label 5' and put an arrow head on 3' ends. c. The top strand would be the circle one: (leading strand / lagging strand) d. RNA primase and helicase are both what type of biomolecules (polymers). e. is the catalyst that adds new nucleotides of DNA.

4.) Below is a replication fork. This is half of a replication bubble. 3' 3' a. Draw a circle to indicate the location of the helicase and an arrow to show the direction it is moving. b. On each DNA template, draw just one RNA primer (short, thick line) and the new DNA (longer). Label 5' and put an arrow head on 3' ends. c. The top strand would be the circle one: (leading strand / lagging strand) d. RNA primase and helicase are both what type of biomolecules (polymers). e. is the catalyst that adds new nucleotides of DNA.

Name: 4.Below is a replication fork. This is half of a replication bubble.3
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 4.Below is a replication fork. This is half of a replication bubble.3'3'a. Draw a circle to indicate the location of the helicase and an arrow to show the direction it ismoving.e.b. On each DNA template, draw just one RNA primer (short, thick line)

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 7TYK

See similar textbooks

Similar questions

Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules _______. a. are from different organisms b. have different lengths c. have different nucleotide compositions d. have different genes
If a segment of DNA is 5 CATTAC 3, the complementary DNA strand is (a) 3 CATTAC 5 (b) 3 GTAATG 5 (c) 5 CATTAC 3 (d) 5 GTAATG 3 (e) 5 CATTAC 5
2. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices a. C b. G c. A d. T
1. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? a. C b. G c. A d. T 2. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′ 3. This complex assembles and organizes nucleosomes and contributes to gene repression a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 4. Amino acids at the N-terminal end of eukaryotic polypeptides that contain the information required for the post-translational processing and…
1. The enzyme that fills the gaps between the Okazaki fragments is ________. a.DNA polymerase b.Helicase c. Ligase d. Primase 2. After helicase unwinds the two DNA strands, ____________ bind to the single stranded DNA. This keeps the two single stranded DNA separated. a. Topoisomerase b. Single stranded binding proteins c. Ligae d. DNA polymerase 3. To synthesize a new strand of DNA, DNA polymerase requires: a. inorganic phosphate b.dNTPs (dATP, dCTP, dGTP, dTTP) c. a free 3' OH group d.ATP e. template DNA Please answer asap and type your answer and do not copy from anywhere please
DNA that has been labeled with 15N is used as the template for replication. Replication is carried using 14N labeled dNTP's. After 3 rounds of replication, what percent of DNA molecules have one strand containing 15N and one strand containing 14N? A. 50% B. 75% C. 25% D. 100%
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
1. The DNA strand which is mostly like to form DNA Z DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: A, none of the above, B, C, D 2. The DNA strand whose complementary RNA contains a stop codon starting at the 5' end DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: none of the above, A, B, C, D 3. The DNA strand of an organism living in volcanic vents is likely to be DNA W = 5' GGG GCT AGC CCC 3' DNA X = 3' ATA TAT ATA CCC 5' DNA Y = 5' TAC GTT ACG TCG 3' DNA Z = 3' ATC TTT GCCA TTA 5' Choices: W, X, Y, Z, none of the above 4. The DNA strand that is most likely to be a promoter sequence DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: A, B, C, D, none of the above
1. TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand. b) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand.
The figure below shows a molecule of DNA with its strands separated prior to DNA replication. The structure labeled “primer” on the figure below: A) will be used to construct the lagging strand B) is made of deoxyribonucleotides (DNA) C) reads 3’ to 5’ from left to right D) was made by DNA ligase