5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C

5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C

Name: 5-ccuaaucg-343'-acctgcctataccggattagetetgatectaagcatgtc-5The diagram
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 5-ccuaaucg-343'-acctgcctataccggattagetetgatectaagcatgtc-5The diagram above shows an RNA primer hydrogen-bonded to a DNA template.Which letter indicates the site where DNA polymerase would add nucleotides to thisstructure?OAOBDAny of these is possibl

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 18RQ: During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol...

See similar textbooks

Similar questions

Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post here
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation due to deletion during replication ?
The following sequence is a double stranded DNA. 5'ATTTGACAATGCGTTAGGCATGACTATGTATAATGCATGCCACATACT... 3' 3'TAAACTGTTACGCAATCCGTACTGATACATATTACGTACGGTGTATGA…5' -35 -10 +1 Where does RNA polymerase initially binds?