5. Frederick Griffith observed that an unknown but heritable substance could move from a dead population of deadly bacteria to a live population of harmless bacteria, making the live population deadly. Oswald Avery and his colleagues later showed that the mysterious "transforming principle" was DNA. a) Explain how the phenomenon that Griffith observed can lead to rapid evolution in bacteria populations. b) Discuss how the transformation process Griffith observed, under controlled conditions, can be used in the arena of genetic engineering.

Q: < Previous Submit Test O 02.CI.Biology.CRM3.2_2023 A scientist discovered a new organic molecule…

A: Introduction  A cell is the basic unit of life and the smallest living component of any organism. It…

Q: Schistosoma mansoni and Clonorchis sinensis are classified taxonomically to which class ?

A: Answer 7:   Schistosoma mansoni and Clonorchis sinensis are both classified taxonomically to the…

Q: How would warmer temperatures affect Km and Vmax on Michaelis-Menton curve?

A: Km in equivalent to that concentration at which initial velocity is one half of the final velocity…

Q: All of the following contribute to a low mutation rate EXCEPT a. high fidelity of DNA polymerase…

A: A mutation is a change in the DNA sequence of a gene, chromosome, or entire genome. This can result…

Q: Explain how humans may have influenced the spread of chytrids

A: Introduction :- Chytrids are a type of fungus that can infect various organisms, including…

Q: estion 2 The basic structural and functional unit of every organism is one of which two types of…

A: Introduction and answer - ► Cell is the fundamental unit of life ► All the living organisms are made…

Q: What is the smallest size DNA fragment produced when pTJ14 is cut with Taql? 1444 757 458 74 434

A: The sizes of the fragments produced by restriction enzyme digestion can be determined by gel…

Q: 1.0 0.98 0.98 6.0E-4 0.57 0.96 0.94 G. scandens 0.42 0.24 G. magnirostris 0.15 G. conirostris 0.39…

A: (1) G. scandens and G. magnirostris  (2) Cam. psittacula and Cam. parvulus (3) Cac. pallida and Cac.…

Q: written answer with explanation and conclusion    A methodology that measures the intensity of…

A: All these techniques mentioned below are designed to measure the concentration of given substance…

Q: Complete the following statements by selecting one of the two options provided. A mutation that…

A: Introduction  Mutation is a change in the DNA sequence of an organism's genome. These changes can…

Q: Provide a disccusion of the treament/managment on microsytic anemia. A 25-year-old female  who is…

A: Microcytic anemia is a type of anemia in which the red blood cells are abnormally small. This can…

Q: If you increase the sample size (n) of a sample, will the following values increase, decrease,…

A: Answer :  1. When n increases, the standard error of the sample mean will decrease. This is due to…

Q: What is the best statement about an apple a day in the diet? It contains a soluble fiber called…

A: An apple is a fruit that is a member of the rose family. Apples are round or oval-shaped with a…

Q: Suppose you calculate that you can load 2000ng of Sample A and suppose your concentration of Sample…

A: * We must figure out how much Sample B is needed to give 2000ng of protein in order to compute the…

Q: 2. Name the layering system and the shape for each epithelial tissue slide image in the chart belo…

A: Epithelial tissue is made up of densely packed cells that serve as a protective covering or lining…

Q: Give written answer with explanation and conclusion  The fluorescent properties of dyes such as…

A: Studying cellular biology is important because cells are the basic unit of life and understanding…

Q: ● 1. Give characteristic of blood pressure in the different parts of vascular system Draw graph

A: The blood and lymphatic vessels which circulate through the body make up the vascular system, also…

Q: What parasites other than those observed can be diagnosed by using blood smears.   Give the names…

A: The parasite Identification helps the analysts to see significant reservoir host,as well as…

Q: Cells can use ATP as a source of energy to drive what type of reactions? a) exergonic Ob) endergonic…

A: ATP stands for adenosine triphosphate, which is a molecule that serves as the primary energy carrier…

Q: What type of moth pollinates columbines? Give typing answer with explanation and conclusion

A: columbines:  Columbines (Aquilegia spp.) are a group of herbaceous perennial plants that belong to…

Q: Is  triose phosphate the simplest monosaccharide? How is it synthesized in plants

A: Since they cannot be hydrolyzed into smaller carbohydrates, monosaccharides are the most basic types…

Q: To what extent do Class and Structure vary in their practical application?

A: Organisms are incredibly complex systems with various behaviors, functions, and interactions. By…

Q: Grasshoppers belong to the Domain _____ the Kingdom _____ and the Phylum____

A: The classification system helps us to identify and classify all the living organisms into different…

Q: Given that the molar extinction coefficient of bsa 43,000 abs m^-1 cm^-1 calculate the absorbance of…

A: Introduction  Absorbance of protein refers to the ability of a protein molecule to absorb light at a…

Q: Match each term with the most appropriate description. Each answer may be used only once. <…

A: Introduction: Redox reactions play an important role in many areas of science, including…

Q: Which statement about the opioid propeptide POMC (pro-opiomelanocortin) is true? All of these…

A: Introduction  Opioids are a class of drugs that act on the nervous system to produce pain relief,…

Q: Analyze your gel image as follows: 1. Are all sample bands clearly defined? Yes or No 2.…

A:

Q: What is the symmetry of the organism in the figures?

A: In biology, symmetry is the ordered repeating of components in an animal or plant. In more detail,…

Q: Question:- True or false: In general, genes are more densely concentrated in the genomes of…

A: Introduction: A genome is the complete set of genetic material, including all the genes, regulatory…

Q: 3. On which skull bone is each of the following marking or structure found? bones a. a. temporal…

A: A skull bone is a hard, rigid structure that forms the skeleton of the head and face. The skull is…

Q: Question 1-15 In the past, some scientists accepted the theory of spontaneous generation. This…

A: Cell is a basic structural and functional unit of life. It consists of aqueous compartment…

Q: transcript the pre-mrna code, ACCUACGCGCCACACGUUCUCUACUAUCCCC, into mature mrna

A: Nucleic acids are "proteins essential to the structure and operation of all living cells. Nucleic…

Q: Given what you have learned about tumor suppressors and proto-oncogenes, predict whether the…

A: Introduction :- Oncogenes are genes that, when mutated or overexpressed, can cause cells to grow and…

Q: Soora එම 900 59%8 O These are cells in the parotid gland. What sha (squamous, cuboidal, or columnar)…

A: The parotid gland is one of three pairs of important salivary glands present in the head and neck…

Q: Differentiate Action Potential and Graded Potential of the Muscular System and the Nervous System.

A: Both action potentials and graded potentials are crucial for the proper operation of the…

Q: In the body, which process converts the chemical energy in glucose to the chemical energy in ATP? a)…

A: ATP (adenosine triphosphate) is the primary energy currency in cells and is essential for many…

Q: Contrast the reactions that build muscle to the reactions that break meat down. How are…

A: Introduction :- Macromolecules are large molecules that are made up of smaller subunits called…

Q: The diagram below shows one way in which an enzyme functions. Describe this type of action, and…

A: An enzyme is a type of protein that acts as a catalyst to speed up chemical reactions in living…

Q: .How do biological characteristics of airborne diseases impact the H1N1 or swine flu outbreak of…

A: Introduction :  Initially, the H1N1 virus that causes swine flu could only infect pigs. The only…

Q: The ΔG of the following reaction is –2.8 kcal/mol: acetyl phosphate + ADP ↔ acetate + ATP Is ADP…

A: Introduction :- Fermentation is an anaerobic process that occurs in the absence of oxygen and…

Q: Label the human testis

A:

Q: Tasks • 1. The level of blood pressure in a man in the first research makes 115/70 mm Hg (15,3/9,3…

A: Blood pressure is a measure of the force of blood  that is exerted against the walls of the…

Q: ABC Table 1. Free-Living Worm Compared to Parasitic Worm Feature Free-Living Worm (Planaria) nervous…

A: Introduction  An organ system is a group of organs that work together to perform a specific function…

Q: Discuss in detail the data of the current uk public helath statergies in tackling type 2 diabetes.…

A: Introduction  Type 2 diabetes is a chronic metabolic disorder that affects how the body processes…

Q: eproduction and Genetic Variation Unit Test Sill: Attempt 2 2 5 8 -- 11 14 MA 3 ✓ 6 ✓ 9 1- 12 15 V…

A: Introduction :  A single cell divides twice to form four cells during the meiosis process.The amount…

Q: Under the neutral theory of molecular evolution, the rate of evolution of a DNA sequence that…

A: The question pertains to the neutral theory of molecular evolution, which proposes that the majority…

Q: A phenotypically normal boy has 45 chromosomes, but his sister, who has Down syndrome, has 46.…

A: Genetic information is stored in chromosomes, which are long, coiled strands of DNA. Most human…

Q: Modern forensic scientists commonly rely on ________________ as empirical evidence in criminal…

A: The scientific methods used to investigate crime. The most common laboratory disciplines in forensic…

Q: label the conjugation tube and the zygospore. Is mature Spirogyra haploid or diploid? What type of…

A: Algae is aquatic, photosynthetic eukaryotic organism.  It comprises of following division:-  I )…

Q: Big sagebrush has enormous variation in genome size among individuals, and its genome is many times…

A: Introduction  A genome is the complete set of genetic information present in an organism, encoded…

Prokaryotic evolution

The term evolution means the gradual change or a transformation from a simple or primitive state to a complex or advanced state. Prokaryotic evolution is a concept that involves the evolution of the form and function of most primitive organisms (prokaryotes) through several stages and changes to form diverse life as a part of organic evolution.