5. Which correctly describes a process or event in the female repro- ductive cycle? A. The cycle is regulated via a negative feedback loop. B. The corpus luteum releases an egg into a fallopian tube. C. Estrogen and progesterone cause a follicle to mature. D. Pituitary hormones cause the uterine lining to be shed monthly. Е. A maturing follicle causes the uterine lining to build up.

Q: If your results plate was the image labeled RESULTS, as compared to the image labeled as the EXAMPLE...

A: ANSWER;- 1. While image 1 shows the pure form of colonies of E.coli because it appears the same in c...

Q: The compound 2,4-dinitrophenol (DNP), which was used in diet pills in the 1930s but later shown to h...

A: Mitochondria is a site for aerobic phases of cellular respiration in cells. 

Q: nucleoid ribosomes plasma membrane flagella lysosome mitochondria nucleolus prokaryotic only eukaryo...

A: Prokaryotic and eukaryotic cell share few similarities however show so many difference in their stru...

Q: At the playground, a bully has been causing other students to play whatever games they want. Althoug...

A: Many weaker boys uniting together to fight against a single stronger boy is a kind of group behavior...

Q: Acetic acid (a weak acid with a pKa of 4.75) and ethanol (an alcohol) are each composed of two carbo...

A: The plasma membrane is primarily composed of lipids. These are made up of fatty acids and glycerol. ...

Q: Compare the advantages of Linnaean and phylogenetic classification systems

A: Introduction: Classification is a very important aspect of Biology. It has greatly eased the study o...

Q: What does phylogenetic classification involve?

A: Cladistics is the most popular method of adding data into phylogenetic trees. Cladistics are theorie...

Q: 1) What makes the heart sounds? 2) Know the whole cycle/route that the blood takes from the heart th...

A: 1.Blood does not pass back from the atria into the great veins because the roots of great veins are ...

Q: 3. Red-green color blindness (b) is a recessive sex-linked trait. A colorblind male marries a normal...

A: * Red-green color blindness is also called as deuteranopia. * The affected individuals having this t...

Q: Ronald was the victim of an assault and has symptoms of posttraumatic stress disorder as well as dep...

A: The diagnosis of the disease is very important in medical science. It helps in proper treatment and ...

Q: 21. Based on their shape and arrangement, identify the type of microbes.

A: Bacteria can be termed as group of prokaryotic, unicellular living beings that can be found in sever...

Q: Chimpanzees, bonobos, and orangutans cannot speak like us because A: They are too stupid. B: Their a...

A: Speech is a communication that is used to express our thoughts in words. 

Q: Figure It Out #5...Name that Complex Carb Fiber Sucrose Starch and Fiber Human Brain Human Liver Coo...

A: Galactose: Human Brain Fiber and Starch: Whole wheat bread Fiber and Sucrose: Starburst, Strawberry ...

Q: INTRUCTIONS: Place a check on the box if the organ/structure is present in billy goats/bucks. Leave ...

A: Male reproductive system of bucks The male reproductive system consists of testicles,which produce s...

Q: Frog Human Dog -Lizard Duck Whale Duck and whale are close relatives. Frog is equally related to bot...

A: Phylogenic tree is a diagrammatic representation showing evolutionary relationships between organism...

Q: An 82-year-old woman is brought to the emergency room complain- ing of nausea, vomiting, muscle cram...

A: The correct Answer is C

Q: Select all the possible evidence that can be use to support the Theory of evolution 1. Fossil reco...

A: The process of organisms changing over time is known as evolution.

Q: 7. Describe the variety of phytoplankton and zooplankton in the sublittoral study site (Site C). How...

A: Organisms and their environments are inextricably linked and interdependent. Every alteration in the...

Q: Given the DNA of the three organisms, determine the mRNA, IRNA, and the amino acids that correspond ...

A: There are 64 possible codon for four nucleotides out of 64 codon 61 code for Amino acids and 3 do no...

Q: 4. Explain the roles of each of the S main components of the electron transport chain. What are thei...

A: Because they include a pair of electrons with a high transfer potential, NADH and FADH2 produced dur...

Q: Mitochondrial oxidation of fatty acids is a major source of ATP, yet fatty acids can be oxidized els...

A: Introduction  All cells require energy to survive and energy comes from respiration or metabolism. T...

Q: Aside from Sanger Sequencing, what are the other DNA sequencing methods that are available today? Se...

A: Sanger sequencing is a DNA sequencing technology that uses electrophoresis and is based on DNA polym...

Q: What is the importance of Recombinant DNA Technology in the Molecular Laboratory

A: Recombinant DNA technology- Recombinant DNA technology is the joining of two different DNA molecules...

Q: What is one manner in which ERAD may identify misfolded proteins? Why is dislocation of these misfol...

A: Proteins are the essential biomolecules that play a diverse role. Almost all cellular activities are...

Q: The role of creatine phosphate in muscle cells is to: provide energy for muscles during extended phy...

A: Creatine phosphate serves as an “energy buffer” in muscle it is a high-energy, phosphorylated, nitro...

Q: Describe crossing over and how it introduces variation in traitsamong the offspring of sexual reprod...

A: The offspring of sexual reproduction inherit genes from both parents. Furthermore, the offspring pro...

Q: Neuron Z has GABA receptors. TRUE FALSE Neuron Y is hyperpolarized by Glycine. TRUE FALSE Neuron Z h...

A: Neurotransmitters are termed as a body's chemicals signals and messengers. 

Q: Create a flow chart on how to prepare a nutrient agar

A:                                                                      Nutrient Agar            ...

Q: What additive ingredients are thickeners? Total Fat Sat. Fat Cholesterol Sodium Total Carbohydrate D...

A: Out of the option given all are used as thickeners except caramel colour. Caramel colour is a sugar ...

Q: Meiosis_______ . a. occurs only in animals b. supports growth and tissue repair in multicelled  spec...

A: Meiosis is a cell division that forms four progeny cells from a single parent cell.  

Q: Hello, can you pls explain the 5 different swimming styles and strokes. Thank you.   • freestyle ...

A: Answer  5 different swimming styles and strokes 1.free style 2. Back stroke 3. Breast stroke 4. Butt...

Q: Activity no. 5.1 DNA Model Name Section Directions: Use the patterns of the components of DNA provid...

A: Your model has attached in Step 2. I'll give the model with partial colouration. I don't have brown ...

Q: F1

A: Phenotype-the ratio of offspring manifesting a particular trait. F1-the first flial generation seeds...

Q: How biodiversity reflected the environment?

A: Introduction: Biodiversity means the diversity of life forms. It is a word commonly used to refer to...

Q: Plants use the proton electrochemical gradient across the vacuole membrane to power the accumulation...

A: Plant cells have vacuoles that accumulate excess salts and water.  

Q: Why is the mechanism of ATP synthesis shared among both prokaryotic organisms and eukaryotic organel...

A: Adenosine triphosphate (ATP) is the energy-carrying molecule found in the cells of all living things...

Q: . In fruit flies, brick-red eye color is dominant to a bright orange color called cinnabar. A fruit ...

A: Introduction: Scientific name of fruit fly - Drosophila melanogaster.Drosophila melanogaster is a sp...

Q: Give the functions of the following bacterial structures. Granules Pili Flagella Endospores Capsule

A: Bacteria is a prokaryotic cell which has many organelles to facilitate different functions.

Q: Explain the Baroreceptor Reflex and how it regulates BP & HR. What are the receptors and neural path...

A: The baroreflex or baroreceptor reflex is a homeostatic mechanism in the body that contributes to the...

Q: Cytoplasm of a plant cell divides by the process of_____ . a. telekinesis c. fission b. nuclear divi...

A: Introduction Cytoplasm is a viscous liquid that fills each cell and is surrounded by the cell membra...

Q: action of beta-lactam, aminoglycosides, polyenes, and quinolone antimicrobial agents on bacterial ce...

A: Microorganisms are killed or slowed by antimicrobial agents. Bacteria, viruses, protozoans, and fung...

Q: Highlight the answer or write it in short sentences

A: A phenotype is the physical expression of DNA. In contrast, the genotype is the chemical make up of ...

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...

Q: According to Frans de Waal, the two main pillars of morality are Group of answer choices A: Cooperat...

A: Frans d waal is biologist and primatologist, he is known for his study on behavior and intelligence ...

Q: Describe the scope of human population growth

A: Population growth is the increased number of humans in the world. Most of the human history shows th...

Q: 2. Distinguish among inducible, repressible, and constitutive gene operons.

A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all regu...

Q: What is the relationship of evolution and human behavior?

A: The evolution and human behaviour are related to each other. Evolution occur due to natural selectio...

Q: B. Female (Swine) 12 10 Urinary Bladder 13 Urinary Bladder 15 14 13

A: 9) Ovary 10) Oviduct 11)  Uterine horn

Q: Which type of the following play a role in the gravitropic response of plants according to the stato...

A: Statoliths hypothesis Gravity perception is best explained by the starch–statolith hypothesis that s...

Q: Genetic drift and natural selection can both result in rapid evolution. However, A. natural selectio...

A: Genetic drift is the change in frequency of the alleles over generation due to chance i.e. sampling ...