5. You find a mutant with a 10-bp insertion between the (+1) and the upstream promotor sequences. This insertion is composed only of C and G nucleotides.5a) Choose the best answer (1-4) below. This mutation will change1. The sequence of the mRNA2. The sequence of the protein3. Both the sequences of the mRNA and the protein4. Neither sequence will be changed5b) Explain briefly your reasoning for your choice in (5a) above Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as wellas the polarity of the two DNA strands. Analyse this DNA fragment and answer the questions 1-5 that follow.+1-10-353' TTGCATCCGAAACGTACGATCGATESGCCGACTTATTACGATCGGACTACTGCGTCGTAGC5'5' AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATCACGCAGCATCG3'......Provide a brief statement in the space provided1. What is the name if the TATTA sequence at -10 ?2. What is the purpose of the -10 and -35 sites3. What do you understand by the +1 site4. Write the letters for the bases of the first 6 nucleotides of the mRNA molecule transcribed from this gene. Indicate the 5' and 3' end in your answer

Name: 5. You find a mutant with a 10-bp insertion between the (+1) and the
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 5. You find a mutant with a 10-bp insertion between the (+1) and the upstream promotor sequences. This insertion is composed only of C and G nucleotides.5a) Choose the best answer (1-4) below. This mutation will change1. The sequence of the mRNA2. T