Give the corresponding strand of the DNA having the sequence of: a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’ b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’ c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’
Q: If the nucleotide sequence of one strand of DNA is 5′ ACGTTGCA 3′, what is the sequence of the…
A: In molecular biology, the DNA is made of two complementary strands which runs antiparallel to each…
Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…
A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…
Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…
A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…
Q: A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C]…
A: According to Chargaff's rule the percentage of Adenine [A] is equal to Thymine [T]. So if the given…
Q: Using Chargaff's rule, determine the percentages of all of the bases in DNA that is 26% thymine.
A: DNA stands for Deoxyribonucleic acid. It is the genetic material present in all living organisms. It…
Q: A key difference between B DNA and Z DNA is thata. B DNA is right-handed, whereas Z DNA is…
A: DNA is the molecule which carries the genetic information of the cell. It is a long biopolymer of…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…
Q: If a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence…
A: Every living organism has Deoxyribonucleic acid (DNA). DNA has a recipe for synthesizing proteins.…
Q: Using the DNA strand shown here as a template, what will be the sequence of the RNA transcript? 5'…
A: A template is the strand that attach to the complementary strand via DNA polymerase and RNA…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: If the sequence of one chain of a DNA double helix is TAACGTA, the sequence of its partner strand in…
A: Chargaff's rule express that DNA from any species of any life form ought to have a 1:1 protein…
Q: Given the following strand of DNA: 5' CATAGCCTTA 3' Which of the following sequences is the…
A: DNA and RNA are nucleic acids present in organisms. DNA is the deoxyribose nucleic acid whereas RNA…
Q: Select the correct complementary strand of DNA for the following DNA sequence ATG GGG CGG ATA TAC…
A: Deoxyribonucleic acid, better known as DNA, is a major gene for most of life. Some viruses use…
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: Given the following sequence for one strand of a double-stranded oligonucleotide:…
A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…
Q: If you have got the following DNA template molecules, which one of them will require more energy to…
A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…
Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…
A: The central dogma of molecular biology is the metabolic process in which the double-helical…
Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…
A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…
Q: One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on…
A: In a DNA molecule each deoxyribonucleotide is made up of a sugar, nitrogenous base and phosphoric…
Q: Which structural feature of DNA is shown in the figure marked as "X"? (A
A: Introduction A DNA molecule consists of two strands that wind around each other like a twisted…
Q: If you have a strand of DNA that is GAGATCTCGC, what is the complimentary strand?
A: DNA is a double helical structure and it is called the genetic material of the cell since carries…
Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…
A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…
Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…
A: The answer is TTTAGCC. The last option.
Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5':…
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…
Q: Assume that you are a RNA polymerase. Which strand is the template strand?…
A: Second one is the template strand for RNA polymerase.
Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…
A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…
Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…
A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…
Q: The sequences of four DNA molecules are given bel ii. TTTCCCGGGAAA AAAGGGCCCTTT iv. GCCGGATCCGGC…
A: DNA molecules are the nucleic acids that contain sugar, phosphate and nitrogenous base. Sugar is…
Q: Which type of information about the nucleotide sequenceof the target DNA is required ?
A: Targeted sequencing is defined as a process in which there is a rapid as well as…
Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with…
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…
Q: Write the sequence of the DNA strand complementary to the following strand:…
A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…
Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…
A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of…
Q: Which of the following DNA sequences will travel the shortest amount down a gel? A ATTGCAGGCCT B…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…
A: They enhance the rate of a reaction without being consumed or modified during the reaction.…
Q: Type the matching bases below in each DNA sequences. A T T C G A C G T C
A: DNA sequence composed of a row of chemical building blocks - called "bases". There are four types of…
Q: If the nucleotide at position 23 in thw first strand of DNA ia changed to "A", what effect would…
A: The change in the nucleotide sequence can occur due to the mutation in the gene expression. These…
Q: What is the term applied to the trinucleotide shown by the arrow? 5' AU Ру AGGCC G C G G G ACCACCUGe…
A: This a structure of tRNA, The tRNA molecule has a distinctive folded structure with three hairpin…
Q: Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will…
A: BamHI is a type II restriction endonuclease that can recognize short DNA sequences (6 bp) and cleave…
Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: Based on one strand of a certain segment of DNA with the sequence below, answer the following…
A: DNA, deoxyribonucleic acid is a molecule which stores the genetic information of an organism and…
Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…
A: Transcription is the process of formation of mRNA transcript. It can be divided into three stages:…
Q: A DNA antisense strand contains the following ucleotide base sequence CGA TIT GGT TGA 37. From thin,…
A:
Q: If you have got the following DNA template molecules, which one of them will require more energy to…
A: DNA is made out of four unique sorts of nucleotides, in particular, adenine, thymine, cytosine, and…
Q: If a region of one strand of a DNA double helix has the sequence 5'-CAGATAC-3', what is the sequence…
A: The nucleotide base pairing is complementary that is two complementary nitrogenous molecules are…
Q: Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:…
A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…
Give the corresponding strand of the DNA having the sequence of:
a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’
b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’
c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Write the sequence of the complementary strand of each segment of a DNA molecule. a. 5 '–AAATAAC–3 'b. 5 '–ACTGGACT–3 'c. 5 '–CGATATCCCG–3 'd. 5 '–TTCCCGGGATA–3Write the sequence of the DNA strand complementary to the following strand: AAATTTCGATCCCGGGAAATTTAGACCCGGGTTTAAACCCCGCATIf a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence (a) ATTCGCGCA. (b) GCCCGCGCT. (c) GCCATATAG. (d) TAACGCGCT.
- Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis, including the functions of the molecules responsible for synthesis. 5’-ATCGCTTGTTCGGAA-3’ 3’-TAGCGAACAAGCCTT-5’The sequence of one strand of DNA is ACCTGC. What is the sequence of the complimentary strand of DNA? A. ACCTCG B. TGGACG C. UGGAGC D. ACCUGC
- What is the complementary sequence of the following DNA strand: AATCGTCTAAGGCCThe template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies
- Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC CGTACGTA ATGCATGC TTGCATCCIf the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following sequence: a. 3'-AATGCTAC-5' b. 3'-CATCGTAA-5' c. 3'-TTACGATG-5' d. 3'-GTAGCATT-5'