6. A deletion mutation occurs, leaving 92 bases in nucleotide sequence. What is the maximum number of aminoacids that could be coded for by this sequence?a. 91b. 30C. 45d. 3Explain WHY.7. Rank the following one-base point mutations with respect to their likelihood of affecting the structure of thecorresponding polypeptide (from most likely to least likely).a. A--> C substitution mutation between the +1 position and the first AUGb.C --> T substitution mutation at the third position of a codon in an exonC.C--> T substitution mutation at the second position of a codon in an exond. deletion mutation in the first exon of the genee. insertion mutation in an exon near the end of the proteinExplain WHY.

Name: 6. A deletion mutation occurs, leaving 92 bases in nucleotide sequenc
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 6. A deletion mutation occurs, leaving 92 bases in nucleotide sequence. What is the maximum number of aminoacids that could be coded for by this sequence?a. 91b. 30C. 45d. 3Explain WHY.7. Rank the following one-base point mutations with respect to t

A codon is a group of three DNA or RNA nucleotides that codes for a particular amino acid or stop…

Answered: 6. A deletion mutation occurs, leaving…

Science

Biology

6. A deletion mutation occurs, leaving 92 bases in nucleotide sequence. What is the maximum number of amino acids that could be coded for by this sequence? a. 91 b. 30 C. 45 d. 3 Explain WHY.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 4TYU: The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds...

See similar textbooks

Similar questions

6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ? b.) Based on the complementary base pairing rules we know that: A(denosine) pairs with _________ , and that G(uanine) pairs with _________.
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
4. If a DNA triplet is CGA A. What is the mRNA codon? B. What is the tRNA anticondon? C. What amino acid does the mRNA code for? 5. If 18% of the nucleotide bases in a DNA molecule are Guanine (G) A. What % of the bases are cytosine (A)? B. What % of the bases are adenine (A) and thymine (T) combined? C. What % of the bases are thymine alone?
1. a) What does DNA stand for? b)What is the name of the DNA structure?
The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide bases
6. The basic functional and structural unit of heredity is A. Gene B. Nucleotide C. Phosphate D. Nitrogen
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
1. A tRNA to which the correct amino acid has been attached is called?
1. How are proteins influenced by mutations in a DNA sequence? 1A: what happens if DNA has a one base mutation in its squence? Provide an example as well
5. If 18% of the nucleotide bases in a DNA molecule are Guanine (G) A. What % of the bases are cytosine (A)? B. What % of the bases are adenine (A) and thymine (T) combined? C. What % of the bases are thymine alone?
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?