g.Is this a silent mutation (no change in amino acid sequence), missense mutation (one amino acid changed to adifferent amino acid), or nonsense mutation (one amino acid changed to a stop codon)? Explain how youknow. 1. Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right.5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC -3'56111+---+-------+--*a.Draw a green box around the promoter.b. Label the template strand of the DNA on the sequence above.C. Write the sequence of the mRNA.Anticodon sequence:--+---3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG---+---5'd. Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of thepeptide.e. Give the sequence (and indicate the directionality) of the anti-codon on the tRNA that inserts the 2nd aminoacid into the newly made peptide.f. Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T toC/G. What would be the effect of this mutation on the produced peptide?

Name: g.Is this a silent mutation (no change in amino acid sequence), misse
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: g.Is this a silent mutation (no change in amino acid sequence), missense mutation (one amino acid changed to adifferent amino acid), or nonsense mutation (one amino acid changed to a stop codon)? Explain how youknow. 1. Part of a gene is written bel

Gene is present on a chromosome and contains hereditary information. These genes are later…

Science

Biology

Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC 1 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG -3' 56 -5'

Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC 1 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG -3' 56 -5'

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA is not used directly for protein translation (i.e., why is mRNA used instead?).c. Explain what occurs when a gene’s promoter region is open for RNA polymerase binding.d. Explain what occurs when a gene’s promoter regions is blocked from binding RNA polymerase.e. Explain how two cells, such as liver cells and skin cells, can become specialized in structure and function despite containing the same genome.
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
1.- Outline the general process of transcription (dna->rna) include a diagram a) include the basic enzymes involved and a description of their actions b) what is the product of transcription c)what will the cell do with the product d)where does the transcription take place in prokaryotic cell
1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A. 5’-CGU-UAC-AGG-CCA-3’ B. 3’-CGU-UAC-AGG-CCA-5’ C. 5’-CGT-TAC-TGG-GCA-3’ D. 3’-CGT-TAC-TGG-GCA-5’ 2. Which is the correct amino acids using the mRNA strand of 5’-AUG-CAU-CAA-3’? A. MET-HIS-GLN B. GLN-HIS-MET C. MET-GLN-HIS D. HIS-MET-GLN
1.A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine 2. Active transcription does not occur in regions of chromatin loops that are located ________. Group of answer choices a. A large distance away from the MARS b. Within the euchromatin c. Near the MARS d. A large distance from the telomere 3. Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent mutation? Group of answer choices a. 5′-AUG GUU AGA GUU GAA AAA-3′ b. 5′-AUG GCU UGA GUU GAA AAA-3′ c. 5′-AUG GCU AGA GUU GGA AAA-3′ d. 5′-AUG GCU CGA GUU GAA AAA-3′
The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C
1. The specific sequence component of the bacterial promoter located 10 base pairs upstream of the bacterial gene start site is called?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’(a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect?
a. The promoter is to the right so transcription goes right to left.b. This sequence 5’ AGCTACGGGGTG 3’ is a part of the template strand from the MIDDLE of gene. Write it in the middle of one of your lines. Use pencil in case of errors. c. Write the sequence of the coding strand of DNA on the other line. d. Indicate the start of transcription with an arrow like this and write “promoter” where it must be located. e. Draw a thicker (or different colored) line to indicate a strand of newly synthesized mRNA. Label 5’ and 3’ ends. By the template sequence on your diagram, write the sequence of mRNA that is produced from this template. f. In what ways are the sequences of the coding strand and the mRNA similar? g. In what ways are the coding strand and the mRNA different?