6. Why is DNA replication considered to be semiconservative? a. Each original DNA strands makes a copy of its complementary base pair. b. Each original DNA strands makes a copy of itself. c. It keeps half of the old nucleotides. d. None of the above. 7. Which enzyme separates and unwinds the DNA strands at the beginning of replication? a. helicase b. ligase c. gyrase d. topoisomerase

6. Why is DNA replication considered to be semiconservative? a. Each original DNA strands makes a copy of its complementary base pair. b. Each original DNA strands makes a copy of itself. c. It keeps half of the old nucleotides. d. None of the above. 7. Which enzyme separates and unwinds the DNA strands at the beginning of replication? a. helicase b. ligase c. gyrase d. topoisomerase

Name: Pls help ASAP on both questuons pls I BEG 6. Why is DNA replication co
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Pls help ASAP on both questuons pls I BEG 6. Why is DNA replication considered to be semiconservative?a. Each original DNA strands makes a copy of its complementary base pair.b. Each original DNA strands makes a copy of itself.c. It keeps half of the

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 8TYU: The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is...

See similar textbooks

Similar questions

2. What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b. It displaced a lot of proteins to free the DNA. c. It disrupts the phospholipid bilayer. d. It precipitates the DNA.
1. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′ 2. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices a. C b. G c. A d. T 3. A scientist, Dr. Doom would like to create a novel antibiotic by targeting translation in bacterial cells. Which enzyme(s) would Dr. Doom need to target to prevent translation at the transcriptional stage? Group of answer choices a. RNA Polymerase…
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
(a) What is the function of helicase in DNA replication?(b) What is the function of DNA polymerase?(c) What are replication forks? Compare and contrast leading and lagging strands. Answer all please
1. Describe the relationship between chromosomes, cells, and DNA2. [Use Pictures] - How does the model describe about the structure of DNA3. Why do scientists use models? What are the limitations of models?
When two adjacent bases in the same strand of DNA dimerize (form a covalent bond between them), what happens to the DNA? a. the original strand of DNA now contains a new DNA sequence b. the original strand of DNA is prevented from opening during replication, so this section of DNA will not be replicated c. the original strand of DNA is methylated, which causes the bases to mismatch d. the original strand of DNA is kinked, which prevents DNA polymerase from working properly e. the original strand of DNA is unaffected, so no additional mutations arise
1. How may recombinant DNA molecules be introduced into human cells? a. by splicing the needed genes into a mammalian chromosome using restriction enzymes. b. by adding plasmids to the mammalian cells. c. by using engineered viruses as vectors. d. by using a gene gun. 2. If someone is accused of a crime, investigators can collect his or her DNA to compare the DNA of the cells found at the crime scene. To collect human DNA, investigators often swab the inside of person’s cheek. Just a few human cheek cells contain enough material to perform PCR. In a cell, the nucleus and mitochondria contain DNA that is the starting material for PCR. Identify the 4 components needed to start a PCR reaction (equipment not included)
2, Semiconservative replication means _____ a, DNA replication conserves some energy b, one daughter strand of DNA conserves the parent strand while the other daughter strand is new DNA c, half of the parent strand of DNA is part of each of the daughter strands d, DNA votes Republican about half of the time 3, which three nucleotides could be found in RNA but not DNA? a, T,G,A b, A,U,C c, C,G,T
In DNA replication, what is meant when we say it is “semi-conservative”? a. One new DNA molecule contains the parent strands and the other DNA molecule contains only new strands b. Both new DNA strands contain a parent strand and a template strand c. The new DNA molecules are exactly like the original strand d. Some of the genes are replicated, some aren’t
1. How can you modify your DNA model to reflect changes among DNA molecules? 2. How can a DNA molecule make an exact copy of itself?
(1) DNA polymerase can only add nucleotides to an available 3' end. Why? a. The enzyme is attracted to the negatively charged phosphate group. b. The phosphate group at the 5' end interferes physically and/or electrically with the elongation process. c. The lagging strand needs to be synthesized more slowly. d. Okazaki fragments are critical to the formation of identical copies of DNA. e. No one knows.