7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a different way you can determine reading frame. a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species. The sequences are aligned but the reading frame is unknown. What is the reading frame for these sequences? (ie., Does the first complete codon begin at the first, second, or third nucleotide?) Hint: Think about what you know about the nature of mutations, natural selection and the genetic code. 1. Bear CCTGAAGAGCTACCTCCG CTCCCTG C G G C C G GAGGCTGAGAATAACCCC GG CCGCCCT CCTGAAGAGCTACCTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTG GCC G C CCT 2. Human 3. Chicken 4. Cow CTTGAAAAGCTACCTACGCTCTCTGAGACCCGACGCTGAGAATAACCCTGGTCGTCCA CCTGAAGAGTTACCTCCGTTCCCTG C G G CCT GAGGCTGAGAATAACCCCG GCC GCCCT

7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a different way you can determine reading frame. a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species. The sequences are aligned but the reading frame is unknown. What is the reading frame for these sequences? (ie., Does the first complete codon begin at the first, second, or third nucleotide?) Hint: Think about what you know about the nature of mutations, natural selection and the genetic code. 1. Bear CCTGAAGAGCTACCTCCG CTCCCTG C G G C C G GAGGCTGAGAATAACCCC GG CCGCCCT CCTGAAGAGCTACCTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTG GCC G C CCT 2. Human 3. Chicken 4. Cow CTTGAAAAGCTACCTACGCTCTCTGAGACCCGACGCTGAGAATAACCCTGGTCGTCCA CCTGAAGAGTTACCTCCGTTCCCTG C G G CCT GAGGCTGAGAATAACCCCG GCC GCCCT

Name: 7. If you have aligned orthologous gene sequences from an important,
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a differentway you can determine reading frame.a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species.The s

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 8TYK

See similar textbooks

Similar questions

1. If the gene above is transcribed into a functional mRNA,a.) how many codons will be carried by the functional mRNA?b.) what is the sequence of the 25th codon?c.) what is the sequence of the stop codon?2. If the mRNA transcribed for this gene will be translated into a functional protein,a.) how many amino acids will be used to build the polypeptide chain?b.) what is the amino acid coded by the 25th codon?c.) what is the amino acid coded by the last codon?
2ith the diagram provided please write the polypeptide. sequence obtained from the translation of the black allele gene
1. What would be the amino acid sequence encoded by the mRNA5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
1. If a mutation occurs in a coding region a. it will cause a change or changes in the normal (wild type) amino acid sequence. b. the protein may not form correctly and as a result does not perform the intended function. c. the type of mutation can be a missense mutation if there is some or limited protein function. d. the type of mutation can be a nonsense mutation if there is no protein function. e. all of the above 2. If a mutation occurs in a non-coding region: a. it will cause no change in the normal (wild type) amino acid sequence. b. the protein is unaffected and still functions correctly. c. the type of mutation is called a silent mutation. d. the protein may not form correctly and as a result does not perform the intended function. e. all of the above
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. The first base in the tRNA anticodon loop is also wobbling, that is one tRNA is able to pair with several codons of mRNA. If the firs base of the anticodon is U, its complement in the codon is: a.A or C b.A or G c.C or G d.A or U 2. The probability of an offspring having all the recessive traits from the cross AaBBCc X AaBbCC is: a.one-sixteenth b.three-fourth c.zero d.nine-sixteenth 3. The probability of an offspring having all the dominant traits from the cross AaBBCc X AaBbCC is: a.three-fourth b.one-sixteenth c.nine-sixteenth d.zero
4. Gene expression in mammals can be increased by which of the following mechanisms? A. X-chromosome inactivation (as in the case of the female tortoiseshell cat) B. histone demethylation C. histone methylation D. histone deacetylation E. histone dephosphorylation 5. Which of the following DNA components is found on the exterior of this double-stranded molecule? A. the nitrogenous bases B. the pyrimidine bases C. the ribose sugars D. the purine bases E. the phosphates
4) The fact that splicing is a strategy to optimize the use of the genome in eukaryotes is evidenced in C. elegans, which with 20,000 genes can synthesize more than 20,000 proteins. True or false 7) The mutation in the myostatin protein that results in mice with hypertrophied muscles results from a premature stop codon that results in a truncated (shorter than necessary) protein that loses its function of stopping cell division of muscle cells. What post-transcriptional quality control mechanisms fail here? (two apply) a) polyadenylation b) NMD c) splicing d) capping e) methylation 10) The nuclear transplant experiment results in: a) KO or knockout b) transgenic organisms c) RNAi (interference) d) animal cloning
1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner and also induce conformational changes in the DNA. Describe the purpose of thses two modes of interaction with the DNA. 2. Draw the structures of the amino acid side chains that correspond to the following histone modification: a) acetylation of lysine; b) phosphorylation of serine; c) phosphorylation of histidine. How do thses modifications change the character of their respective side chain?
5. While exploring the human genome, a geneticist happens upon a gene in humans that is not functional and is not currently being expressed. This gene appears to be similar to the genes found in modern monkeys that cause tail formation. The most likely explanation for this gene in humans is Group of answer choices a. The gene is lying in wait for when it will be needed and then activated when the opportunity arises b. The gene is a conserved gene that serves an essential function in modern humans c. Humans are likely evolving a tail, and the gene will be expressed in the future d. The gene Is a random mutation of no significance e. The gene is a pseudogene leftover from when human ancestors had a tail
1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…