7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a different way you can determine reading frame. a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species. The sequences are aligned but the reading frame is unknown. What is the reading frame for these sequences? (ie., Does the first complete codon begin at the first, second, or third nucleotide?) Hint: Think about what you know about the nature of mutations, natural selection and the genetic code. 1. Bear CCTGAAGAGCTACCTCCG CTCCCTG C G G C C G GAGGCTGAGAATAACCCC GG CCGCCCT CCTGAAGAGCTACCTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTG GCC G C CCT 2. Human 3. Chicken 4. Cow CTTGAAAAGCTACCTACGCTCTCTGAGACCCGACGCTGAGAATAACCCTGGTCGTCCA CCTGAAGAGTTACCTCCGTTCCCTG C G G CCT GAGGCTGAGAATAACCCCG GCC GCCCT
7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a different way you can determine reading frame. a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species. The sequences are aligned but the reading frame is unknown. What is the reading frame for these sequences? (ie., Does the first complete codon begin at the first, second, or third nucleotide?) Hint: Think about what you know about the nature of mutations, natural selection and the genetic code. 1. Bear CCTGAAGAGCTACCTCCG CTCCCTG C G G C C G GAGGCTGAGAATAACCCC GG CCGCCCT CCTGAAGAGCTACCTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTG GCC G C CCT 2. Human 3. Chicken 4. Cow CTTGAAAAGCTACCTACGCTCTCTGAGACCCGACGCTGAGAATAACCCTGGTCGTCCA CCTGAAGAGTTACCTCCGTTCCCTG C G G CCT GAGGCTGAGAATAACCCCG GCC GCCCT
Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Chapter19: Genomes And Proteomes
Section: Chapter Questions
Problem 8TYK
Related questions
Concept explainers
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Topic Video
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning