geneticist happens upon a gene in humans that is not functional and is not currently being expressed

Q: 1. What is the effect of RNAI on gene expression? A. Knock out B. Knock down C. Knock up D. Knock in

A: RNAi means RNA interference which is a biological process in which miRNA / siRNA neutralizes the…

Q: The Human Genome Project was created in 1990 as an international effort began to analyze the human…

A: The Human Genome Project was an international scientific research project with the aim to determine…

Q: A mouse gene was identified and determined to be required for formation of heart muscle. A gene with…

A: Almost all species have DNA as their genetic material.

Q: (20)Genetic engineering utilized to create food sources has been said to be both like and unlike…

A: Genetic engineering is a biotechnological application that enables the development of genetically…

Q: 2. In your own words, describe two different reasons why a eukaryotic cell may need to control gene…

A: gene expression is a process to regulate the production of active gene to produce the proteins to…

Q: How had DNA Microarray Technology revolutionized the study of gene activity?  a) gene expression in…

A: A DNA microarray (also known as a DNA chip or a biochip) is a collection of tiny DNA patches that…

Q: 1) What do you want to learn, if anything, about your own genome? Answer: Honestly i am not a…

A: The trillions of cells in a human organization, based on particular structural and functional…

Q: The first attempts at gene therapy began in 1990 with the treatment of a young girl with a genetic…

A: SCID stands for Severe combined Immunodeficiency. SCID is a group of very rare, life-threatening…

Q: 2. An enhancer, located upstream from a gene, has the following sequence: 5' – GTAG – 3' 3'- САТС -…

A: Enhancer is the region of gene sequence that can be recognized by the transcriptional factor or…

Q: 1. Since 1978, scientists used a specific biotechnology to produce a medicine used to treat…

A: Technology used: Recombinanant DNA.                 technology. The technology used to make DNA from…

Q: 1. What are ethical issues related with GMOS? Do you think human cloning should be allowed or should…

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: Describe the central dogma of molecular biology.

A:

Q: 20. Fill in this table with the effects that this mutation would have on mRNA and protein sequence…

A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…

Q: 3. Describe the process of genetic engineering and how scientists manipulate genes:

A: genetic engineering is the process of manipulating genome to develop useful products or…

Q: We all carry about 20,000 genes in our genome. So far, patents have been issued for more than 6000…

A: A type of intellectual property that gives the inventor an exclusive right for his/her invention is…

Q: Mutations that confer no apparent selective advantage or disadvantage in a particular environment…

A: Introduction:- Mutations are defined as the changes in the DNA sequence or number that leads to…

Q: Contrast positive versus negative regulation of gene expression. Describe the role of the repressor…

A: Positive and negative control of gene expression In some cases, the product of a regulatory gene is…

Q: 5. You find a mutant with a 10-bp insertion between the (+1) and the upstream promotor sequences.…

A: The transcription is the process of the mRNA formation from gene or DNA sequence. The mRNA so formed…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

Q: 4. In the graph shown below, the dashed line shows the level of MRNA for a certain protein, Prot6,…

A: Anterior-posterior axis is defined by a line that runs from the head or mouth of an organism to the…

Q: 1. Which of the following ensures that most genes on one X chromosome are not expressed in female…

A: Female cells have two X chromosomes while males have one X and one Y. This means females have twice…

Q: List the agents in the environment that can change DNA or increase the frequency of mutations. 2.…

A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: 2) Briefly describe 6 different ways that eukaryotic cells typically regulate Gene Expression

A: Gene expression is the process by which a particular or a set of genes are expressed with the help…

Q: 1. Which is a potential ethical issue resulting from the use of biotechnology? deteriorating the…

A: Human beings utilize the resources of their environment for their benefit. Often there are direct or…

Q: Sequencing the human genome, the development of microarray technology, and understanding of complex…

A: Proteomics is the large-scale study of proteins.Proteomics has enabled the identification of ever…

Q: 1. Do you think the Food and Drug Administration should or should not approve gene therapy…

A: we are answering question 1 only pls repost for rest of question.

Q: 1. Nutritional Genomics is the term used to describe: a. How nutrients affect gene expression b. How…

A: Nutrigenetics is a newly developing field where the "we are what we eat" idiom will get an entirely…

Q: 1. What is RNA? And, how is RNA modified?  2. What are the 3 major steps involved in mRNA…

A: Ribonucleic acid is a molecule similar to DNA. Unlike DNA, RNA is single-stranded.

Q: 1 What is CRISPR? 2. How does CRISPR play a role in Biotechnology?

A: Scientists have  used CRISPR to detect specific targets, such as DNA from cancer-causing viruses and…

Q: 1. Nutrigenomics is the study of how diet and gene expression interact throug molecular mechanisms.…

A: Epigenetic modifications are alterations in the genes without changing the exact or original DNA…

Q: 3. How do we know that expression of the information encoded in DNA involves an RNA intermediate?

A: DNA or  Deoxyribonucleic acid is the genetic material found in all living organisms. DNA is a double…

Q: Which of the following statements about the differential expression of human genes is correct? A.…

A: The Human Genome Project states that genes in human vary greatly in size, ranging from a hundred DNA…

Q: 1. What is a genetically modified organism? How has recombinant DNA technology pushed the boundaries…

A: When the genetic materials of an organisms is artificially altered to get the particular result ,…

Q: What do you want to learn, if anything, about your own genome? (Explain Clearly

A: to learn more about the genome the human genome project was established which tell in detail about…

Q: 1. Describe how regulation of the arginine operon would work? Is the repressor activated or…

A: Enzymes are not being expressed, even once arabinose additional to the medium. arginine is a vital…

Q: notebook. 2. List out some of the notable disorders treated by using gene therapy. 3. Predict the…

A: The process of using genes for the treatment of disease is termed as gene therapy. It is an…

Q: 1.  Two closely related species may have a very similar genome size but very different number of…

A:

Q: The protein neuroD is a critical human protein translated in the brain during development. The…

A:

Q: How can the construct with Cas9 and gRNA sequence be removed from the plant in case it was inserted…

A: Introduction CRISPR-Cas9 is a genome editing tool that's creating a buzz in the science world. It's…

Q: (11) Genetic engineering utilized to create food sources has been said to be both like and unlike…

A: Genetic engineering is a set of molecular biology techniques that enable the scientists to…

Q: 2. Write the base sequence of the hnRNA formed by transcription of the following DNA base sequence.…

A: hnRNA is also called as the heteronuclear RNA. Its synthesis is catalyzed by RNA polymerase II.…

Q: 2. įmagine that you and your colleagues are working in a lab to develop a protein synthesis system…

A: The prokaryotes have a polycistronic mRNA while the eukaryotes have a monocistronic mRNA. The mRNA…

Q: In a fly egg, the nurse cells are killed before they can produce bicoid mRNA.  What will happen?…

A: The development of Drosophila is an important event as Drosophila is utilized as a model organism…

Q: We looked at RNA-mediated mechanisms of gene regulation in both eukaryotes and prokaryotes.  a.…

A: All eukaryotic prokaryotes are homologous to one another and to prokartoyotic RNA polymerase. in…

Q: 1. A recent technical advancement that has accelerated the study of genomes is the ability to? a.…

A: A genome, including its chromosomes, is all the DNA in an organism. Genes hold information to create…

Q: Researchers on the Human Genome Project have determined the nucleotide sequences of human genes and…

A: A patent is an exclusive right that is given for an invention which is not a natural product but can…

Q: 2) a) What would be the effect of introducing a -1 frameshift mutation into the 23S rRNA gene? .: b)…

A: A frameshift mutation is one in which a nucleotide is inserted or deleted in such a way that the…

Q: 1. Do you think genetic engineering is a real solution? What about using genetics as a crime control…

A: Genetic engineering has proved to be a solution for many problems and has been highly useful in the…