8. Consider a relaxed, covalently-closed circular DNA plasmid that has 2080 base pairs with Wr = 0. An intercalator molecule is added, such that there is one intercalator per104 base pairs. The effect of the intercalator is to cause the twist between the base pairs that flank it to be reduced to zero. What will be the resulting change in supercoiling state (i.e., the Linking Number) for the intercalator-bound DNA ?

8. Consider a relaxed, covalently-closed circular DNA plasmid that has 2080 base pairs with Wr = 0. An intercalator molecule is added, such that there is one intercalator per104 base pairs. The effect of the intercalator is to cause the twist between the base pairs that flank it to be reduced to zero. What will be the resulting change in supercoiling state (i.e., the Linking Number) for the intercalator-bound DNA ?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 3TYK: Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning...

See similar textbooks

Similar questions

1 (a) What do ApR, TcR, and ori on the pBR322 map represent and discuss there individual functions? (b)Does the undigested plasmid show more than a single band when electrophoresed? Why? (c)What other kinds of molecules, in addition to plasmid DNA would you expect to find in a sample of plasmid DNA extraction? (This is not a graded assignment)
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.
1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.
5. Which of the following alternative steps cannot be employed in the DNA extraction because it would cause denaturation of some DNA? a. Using vodka instead of isopropyl alcohol. b. Using warm isopropyl alcohol instead of cold isopropyl alcohol. c. Using ammonium chloride for the soapy salt solution instead of sodium chloride. d. Using unscented and uncolored liquid soap for the soapy salt solution 6. Which property of DNA makes it possible to wrap it around the toothpick? a. DNA has a double-stranded helical structure b. DNA is color white. c. DNA is made up of long and thin strands. d. DNA carries genetic information
1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is for DNA polymerase.60-word limit
1. Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to direction?
4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?
4. What is the name of the process by which bacteria pick up a different organism’s geneticmaterial?5. Genetically, how does the original bacterial DNA (plasmid) differ from the final bacterial DNAmolecule? (Do not say, “It is longer.”)6. Tetracycline is an antibiotic that is prescribed to kill bacterial infections. The transformedbacterial cell that you created has the tetracycline resistant gene in it. If this cell is placed on agrowth medium with tetracycline, will the bacteria grow or die? Explain.