Need help rms/d/e/1FAlpQLSf4pNBODhtp6XZ5MLiy4aJP4SwUyY88r3DcxvneABoarLXNAw/viewscore?viewscore=A... ATyrCysUACUGCUAA Stop UGA StopUAG Stop UGG TrpFirst letterGUUCUUAUUGCUUCUCCUACUGPheLeuGUUGUCGUAGUGLeuAUUAUC lleAUAAUG Met>ValACGGCAGUGGCGAUGGUAUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGSerProThrAlaCAUCACCAACAGAAUAACAAAAAG>HisGAUGACGAAGAGGinAsn>LysAspGluCGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGGArgSerArgGlySCAGUCAGUCAThird letterNucleotide atNucleotide at5' End of Anticodon 3' End of CodonCCAUHGсАpairs withI (inosine)U or CGUA or GA, U, or CXX X Consider a tRNA with the following anticodon sequence: 5' U-G-C 3'. Whichcodon(s) would this tRNA bind to (choose one or more)?Before you begin this problem remind your self where the wobble position is in the tRNAand where it is in the mRNA.CARFirst letterUUUUUUCUUAUUGCUUCUCCUACUGPheLeuLeuAUUAUC lleAUAAUG MetGUUGUCGUAGUGValACGGCAUCUUCCUCAUCGGUGGCGSecond letterCCUCCCCCACCGCACUACCACAACGQ SearchSerGCUGCCGCAGCGProThrAlaAUAUTyrUACUAA StopUAG Stop UGGCAUCACCAACAG>HisAAUAACAAAAAGGAUGACGAAGAGGinAsnLysAspGGluUGUCysUGCUGA StopTrpCGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGGArgSerArgGly564G30< >0<]>0<Third letterNucleotide at5' End of AnticodonGCCADHUpairs withI (inosine)Nucleotide at3' End of CodonU or CGUA or GA, U, or CX*

During Protein synthesis messenger RNA contains information in the form of its triplet codons which…

rms/d/e/1FAlpQLSf4pNBODhtp6XZ5MLiy4aJP4SwUyY88r3DcxvneABoarLXNAw/viewscore?viewscore=A... AD Tyr Cys UAC UGC UAA Stop UGA Stop UAG Stop UGG Trp First letter G UUC UUA UUG CUU CUC CUA CUG Pho Leu GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met >Val ACG GCA GUG GCG AUG GUA UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC >His GAA GAG Gin Asn >Lys Asp Glu CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg Gly SUAG UCAGUCA Third letter Nucleotide at Nucleotide at 5' End of Anticodon 3' End of Codon CCAUH G с А pairs with I (inosine) U or C G U A or G A, U, or C X X

rms/d/e/1FAlpQLSf4pNBODhtp6XZ5MLiy4aJP4SwUyY88r3DcxvneABoarLXNAw/viewscore?viewscore=A... AD Tyr Cys UAC UGC UAA Stop UGA Stop UAG Stop UGG Trp First letter G UUC UUA UUG CUU CUC CUA CUG Pho Leu GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met >Val ACG GCA GUG GCG AUG GUA UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC >His GAA GAG Gin Asn >Lys Asp Glu CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg Gly SUAG UCAGUCA Third letter Nucleotide at Nucleotide at 5' End of Anticodon 3' End of Codon CCAUH G с А pairs with I (inosine) U or C G U A or G A, U, or C X X

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
Identify the features of tRNA that are important in decoding genetic information and converting it into protein language.
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
Hi, Could you please comfirm the following question. I have selected option c) because tRNA is the the complimentary pairs of mRNA so I figured the oppside end of the tRNA would be the same as the mRNA. When I have tired to double check my answer, no tutor has selected this answer. Thank you in advance, Like mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AGA and AGU c. AAA and AAG d. UCU and UCA
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptid
Like mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AAA and AAG c. AGA and AGU d. UCU and UCA
a) Identify the current stage of the translation process shown in Figure 1 and name the anticodon sequence in tRNAb) State TWO immediate, main consequences when a stop codon reaches the E site.
An enzyme known as ___________________ attaches an amino acid to the_________________ of a tRNA, thereby producing_______________ . a. aminoacyl-tRNA synthetase, anticodon, a charged tRNA b. aminoacyl-tRNA synthetase, 3′ single-stranded region of the acceptor stem, a charged tRNA c. polynucleotide phosphorylase, anticodon, a charged tRNA d. polynucleotide phosphorylase, anticodon, an aminoacyl-tRNA
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'