A cell in the pancreas has released insulin that travelled to the muscle tissue via the bloodstream and facilitated glucose transport across the membrane. Identify and describe the key characteristics of the type of communication used in the above example.

A cell in the pancreas has released insulin that travelled to the muscle tissue via the bloodstream and facilitated glucose transport across the membrane. Identify and describe the key characteristics of the type of communication used in the above example.

Intro To Health Care

4th Edition

ISBN:9781337338295

Author:Mitchell

Publisher:Mitchell

Chapter16: The Communication Process

Section: Chapter Questions

Problem 1AE

See similar textbooks

Related questions

Q: How will the cell shift its metabolic processes in response to the level of pyruvate and in order to…

A: Cellular respiration is the process by which energy is captured from food in three main stages. They…

Q: Student Y is working with his microbiology experiment, the directions of the agar is to suspend 25g…

A: In microbiology experiment, we generally use 15-20ml media for each petri dish. Here we can consider…

Q: I need help with a biology question on enzyme denaturation, I need help with questions, one and two,…

A: The altering of a protein's molecular structure is known as denaturation. During denaturation, many…

Q: The phylogenetic tree in Exercise 1 above shows an outdated relationship between Brachiopoda,…

A: A phylogenetic tree is a diagram that represents evolutionary relationships among organisms.…

Q: State at least four functions of the kidneys other than forming urine.

A: Introduction :- They are primarily responsible for removing toxins from the blood and turning waste…

Q: Which of the following is an algal infection? fish food poisoning amnesic shellfish poisoning…

A: Phytoplanktons are single cell photosynthetic organisms, which play an important role in aquatic…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: The following contains a lesser concentration of particles in comparison to another body of fluid: O…

A: Introduction When more water is being lost from the body than is being taken in, dehydration…

Q: Compare and contrast the following techniques: FISH, immunofluorescence, and GFP fusion proteins. In…

A: Fluorescence in situ hybridization (abbreviated FISH) is a laboratory technique used to detect and…

Q: List five proteins of the myofilaments and describe their physical arrangement.

A: The myofilaments are the proteins that make up the contractile elements of muscle cells. There are…

Q: The following is passive transport of a solute: O a Diffusion O b. Osmosis Oc. Endocytosis Od. A and…

A: The membrane of the cell is semi-permeable. It permits the passage of certain molecules over the…

Q: 3. Practice "flipping" this question by putting an X on the template for these 4 diagrams.…

A: DNA is the genetic material in living organisms that is composed of two anti-parallel polynucleotide…

Q: Phytonadione, also known as Vitamin K1, is required by the body for the modification of certain…

Q: Which pituitary hormone is represented by the abbreviation ADH? A Antidiuretic hormone B Adrenal…

A: Vasopressin is a hormone released by the posterior pituitary gland (located at the base of the…

Q: A congenital defect mutates the genes that code for RAG1 & RAG2 making them unreadable (therefore no…

Q: A string of 8 uracil nucleotides in the mRNA is required for function of an intrinsic transcription…

A: DNA transmits information to proteins in a continuous flow. DNA controls this basic central dogma…

Q: How can we organize circuits in the spinal cord to create rhythmic patterns?

A: Introduction The spinal cord, which connects the medulla oblongata in the brainstem to the lumbar…

Q: Why do evolutionary biologists give so much attention to this? Explain mechanisms that generate…

A: The word "Genetic" refers to genes and "variation" refers to changes. So genetic variation is…

Q: The effect of on the activity of an enzyme can usually be overcome by increasing the concentration…

A: The term substrate has to be defined. A chemical species that reacts with reagent to form a…

Q: Describe pinocytosis, phagocytosis and receptor mediated endocytosis.

A: Describe pinocytosis, phagocytosis and receptor mediated endocytosis.…

Q: One of the characteristics of botulinum toxin (the cause of 'botulism') is a very specific protease…

A: Neurotransmitters A chemical that secreted by the ends of nerve fiber into the synaptic cleft.

Q: Create a Venn diagram comparing and contrasting the anatomy and physiology of the respiratory system…

A: Introduction: Respiratory system is the network of organs and tissues that help us to breath. It…

Q: What are the neuronal and muscle properties that support the size principle of recruitment?

A: The size principle states that depending on the intensity, the smallest to largest motor units will…

Q: Question:- Which of the following statements about photosynthesis are FALSE? a) Photosystem II…

A: Photosynthesis is the process by which chlorophyll containing organisms produce organic molecule…

Q: you know that 1.1OU=1um. you have an organism that measures at 12 O.U at 10x. How long is your…

A: The capacity of a microscope to create an image of an object at a scale bigger (or even smaller)…

Q: endangerered or threatened animal is Javan Rhinos write a summary on Javan rhinos considering…

A: Endangered species Endangered species are those species whose population is going to extinct near…

Q: 1) Using the equations for cellular respiration and photosynthesis, explain what makes one pathway…

A: We are allowed to do upto three subpart of a question. Please repost the undone questions again.…

Q: Calcitonin reduces Ca+ from the blood true or false

A: Calcitonin is hormone secreted by thyroid. C cells in thyroid gland produce calcitonin. It is a…

Q: What type of cell is this and where are the genes located inside of this cell?

A: Cells are basic structural and functional units of life.There are two major types of cells -…

Q: Explain why the precise length of the template DNA sequence does not become amplified until the…

A: There is always one set of original long-template DNA molecules which is never fully duplicated.

Q: single-stranded double-stranded thymine cytosine adenine hydrogen negative positive covalent…

A: Complementarity in biological sciences refers to the association of two structures that each operate…

Q: 1) Several morphological features of the bird respiratory system allow for more efficient gas…

A: The avian respiratory system is different from that of other vertebrates, with birds having…

Q: Couple 2 PKU heterozygote (carrier) PKU homozygote Couple 1 B. Can couple 3 have a child that has…

A: Since couple 1 who are not affected have affected children - one male and one female, the mode of…

Q: List examples that illustrate how the structure of a body part makes possible its function,?

A: The functionality of cells, tissues, and organs is related to their structure and morphology. It…

Q: List and explain the assumptions and uses of the Hardy-Weinberg Principle. Provide examples (and…

A: HWE The principle state that if forces of evolution is absent then the frequency of genotype of…

Q: You want to product human immunoglobulin G using a recombinant Escherichia coli system. Design the…

A: Recombinant tecnology The technology based on making hybrid DNA. In this technology, gene of…

Q: Is tofu a biotech product? Yes or No. Why?

A: Is tofu a biotech product? Yes or No. Why?

Q: Which stage of succession has the strongest interspecific First stage of succession competition?…

A: The ecological succession is the sequential changes in the species composition in a particular area…

Q: Which of the following statements correctly describes why white muscle fibers do not need is mini…

A: In vertebrates, the muscle system helps with the movements and posture of the body. There are mainly…

Q: Explain why afterload is critical in cardiac function and maintaining long-term heart health

A: The systolic of the heart can be determined by three factors preload and afterload and contractility…

Q: What is the function of LARP1 and where does it bind? Select an answer and submit. For keyboard…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make…

Q: There are multiple potential causes for seizures. Determine which changes to protein function could…

A: Seizures - are neurological disorder, caused due to imbalance between excitatory & inhibitory…

Q: 2 Paul and his friends ate at a fast-food restaurant. Paul, who has a mass of 70 kg, had a…

A: It is required by all the organisms to eat food in order to grow and obtain energy to sustain the…

Q: Fat soluble substance diffuse through the following regions of the selectively permeable cell…

Q: Why are individuals with an extra chromosome 21, that causes Down syndrome, more numerous than…

A: Extra Copy of chromosome cause different effects depend upon chromosome number . Some of the extra…

Q: describe how the circulation (blood vessels) and the heart have integrated functions in providing…

A: Cardiovascular system consist of the blood vessels,its main types are Arteries,Veins and…

Q: The following are the hydrophilic regions of a selectively permeable cell membrane: O a Water Loving…

A: The cell is the smallest structural and, functional unit of life. It is simple machinery that houses…

Q: How does the eye normally adjust to looking at objects atd ifferent distances.?

A: Accommodation is a character of eyes where eyes can produce an image of an object on the retina by…

Q: Name the five types of white blood cells, and state a function for each type

A: Introduction A component of the immune system that guards against infection is the white blood cell.…

Q: in the blanks Bacteria inside termites are ___________ when they live on the outside of protists…

A: Termites are capable of digesting cellulose present in the wood. Cellulose can be digested by the…

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

True or false. Autrine signaling involves movement of signaling molecules into the bloodstream
Compare the following types of communications systems: nervous system, endocrine system, paracrine system, and direct communication in terms of chemical messengers and how or where those messengers travel.
Consider the differences in the nervous system and endocrine system. Shortly say why would the body need both of them if they both accomplish the same main goal of communication?
List the different types of communication signals, and giveexamples of each
If a bear is chasing you, what important things happen to help you escape? Include the endocrine system in answer.
Choose the best term which describe the following statement: antagonist binds to the binding site of receptor and change the shape: Select one: Incorrect Induced fit. Correct induced fit. Signal transduction. Perfect fit.
A neurotransmitter that binds to a G-protein-linked receptor, such as a biogenic amine, that promotes ___________________ is described as having _____________. Group of answer choices slower long lasting effects; indirect action slower long lasting; direct action fast long lasting effects; indirect action fast short lived; direct action fast long lasting; direct action
Hormones such as epinephrine and glucagon stimulate adenylate cyclase to increase what second messenger molecule that results in cellular events such as glycogen breakdown in the muscle and liver cell. Group of answer choices Phosphate cAMP hormone sensitive lipase Sodium
Cells communicate in ways that resemble humancommunication. Decide which of the following forms ofhuman communication are analogous to autocrine, para-crine, endocrine, and synaptic signaling by cells.A. A telephone conversationB. Talking to people at a cocktail partyC. A radio announcementD. Talking to yourself
If a signal activates an intermediate protein it would be considered______ of a protein? a. Hormonal b. Downstream c. phosphorylating d. Upstream
During the stress response, glucocorticoids and catecholamines work synergistically (together) to exert what effect? Question 2 options: to promote immune suppression to promote vasoconstriction to promote vigilance and arousal to promote hyperglycemia
Can you explain it in details