A congenital defect mutates the genes that code for RAG1 & RAG2 making them unreadable (therefore no RAG1 or RAG2 production). Will this person still be able to produce B cells? Why or Why not
Q: what happens if the chromosomes within an individual are not tightly packed. How does this affect…
A: Chromosomes are made up of a DNA-protein complex called chromatin that is organized into subunits…
Q: Is a clean counter bacteria free?
A: Life includes germs on a regular basis. While some of them are beneficial, others are detrimental…
Q: The following is the major extracellular electrolyte diffusing from the ECF into the ICF across a…
A: ECF is extracellular fluid present outside the cellular environment. ICF is intracellular fluid…
Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…
Q: Follicle-stimulating hormone stimulates the production of a. steroids in the adrenal cortex. b.…
A: Hormone Also known as chemical messenger of the body. They are secreted from the different gland…
Q: Sisters U QO The red arrows are pointing at A Sisters U Homologs Sisters and Homologs Neither…
A: As per our company policy, we have to solve first three questions. If you want assistance with other…
Q: V- and t- tethering proteins SNARES GTPases NSFs mediate final docking between vesicle and target…
A: INTRODUCTION : Vesicle docking - Docking is the process in which the vesicle & pre synaptic…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: Hardy-Weinberg equilibrium is a principle stating that the genetic variation in a population will…
Q: How can you differentiate between Cystoisospora (Isospora) belli, Cryptosporidium sp., and…
A: Protozoans are animal protist that are single cell and eukaryotic structure. They are classified…
Q: Given in the photo is a family that has a history of phenylketonuria (PKU). -Couple 1 Couple 2 DTO.…
A: Phenylketonuria (fen-ul-key-toe-NU-ree-uh), additionally referred to as PKU, is an extraordinary…
Q: In detail explain how C3 plant leaf is different from C4 plant leaf and why
A: INTRODUCTION the difference between C3 and C4 plant leaves explained below.
Q: In Lassaigne Nitrogen Test, If a substance is positive for nitrogen, what functional groups may the…
A: Lassaigne Nitrogen Test: In elemental analysis, the sodium fusion test, also known as Lassaigne's…
Q: line on July 12, 2017. According to statistics from the Ministry of Health, there were 2,268 ses in…
A: Leptospirosis is a rare bacterial infection we get from animals. It’s spread through their urine,…
Q: What are the 5 spaces of the infrahyoid neck and the contents of each?
A: We know that The infrahyoid neck is the area of the neck between the hyoid bone and the thoracic…
Q: In measuring photosynthesis in crop species, you find that two species respond differently to a…
A: Introduction Plants and other living things employ a process called photosynthesis to transform…
Q: What technique would you use for each senario(a and b) and why. FISH, immunofluorescence, and GFP…
A: Introduction-FISH In this technique, the full set of chromosomes from an individual is affixed to a…
Q: A transformation experiment is carried out using donor DNA that is A B C and a recipient that is…
A:
Q: What is the name of the organism most likely causing the diesease Syphillis? Streptococcus pyogenes…
A: Syphilis is a sexually transmitted infection (STI) that is usually defined as the way they are…
Q: You are visiting the Dzantik'l Heeni nature reserve, outside Junea, Alaska. Use the illustration…
A: Introduction Species richness: Species richness refers to the total number of species present in an…
Q: Label the features of the tibia: (this is the front view) lateral condyle, intercondylar tubercles,…
A: The tibia and fibula are the bones of the leg and provides the strength to the leg for the movement…
Q: Discuss the absorption of amino acids in the small intestine.
A: Introduction The digestive system's function is to convert the macromolecules present in the food…
Q: Which statement(s) indicates one or more benefits of electroporation? A.) Possibility of…
A: Electroporation The method of making hybrid DNA in cells.
Q: 5. Considering the movement of molecules across the cell membrane; • Contrast the manner in which…
A: Cell membrane also known as plasma membrane is a phospholipid bi-layered structure which is semi or…
Q: During pregnancy, FSH and LH levels should be: High-progesterone stimulates the release of FSH and…
A: We know that Female body undergoes various hormonal changes during pregnancy. Hormonal fluctuations…
Q: the main function of photosynthesis is the A. production of 02. B. conversion of light energy to…
A: The photosynthesis takes place in the chlorophyll containing cells. It takes place in the…
Q: XL 10 Gold cells and Express I^q cells. Give three differences between their genotypes and how each…
A: The XL10-Gold ultracompetent cells were designed for cloning large plasmids and ligated DNA with the…
Q: The cell senses ATP is not being produced. What immediate effect will this have on the rate of…
A: INTRODUCTION ATP Adenosine triphosphate : source of energy.
Q: Follicle-stimulatinghormone stimulates the production of a. steroids in the adrenal cortex. b.…
A: We know that The reproductive system involves the fusion of the male gamete sperm and the female…
Q: As a consumer, how will you react emotionally to having clean and safe water produced from biomass…
A: Biomass is an organic substance which includes plant, animal and municipal wastes used to produce…
Q: Pancreatic acinar cells produce and store hydrolytic enzymes in zymogen granules until hormones…
A: Active transport is a type of membrane transport mechanism in which substances are transported from…
Q: 8 aele 3. Make a Punnett square to show how two people who do not have color- blindness can have a…
A: Colour blindness It is a X-chromosome linked recessive disease.
Q: 6. Some bacteria produce chemicals that provide food with a certain taste. Name two such foods.
A: Hydrochloric acid (HCl) destroys the maximum amount of bacteria in a healthy stomach. Bacteria can…
Q: During which phase of the growth curve are bacteria most susceptible to antibiotics? Why?
A: Introduction : Antibiotics are medications used to eradicate or stop the development of pathogenic…
Q: A female who is heterozygous for tongue rolling reproduces with a male who is homozygous recessive…
A: Genotype can be define as the combination of charecteristics which can be observed by our naked…
Q: Ms. Dominique reports that she normally treats colds and flu with herbal remedies. How should the…
A: The nurse must develop cultural sensitivity & become culturally competent by gaining information…
Q: Question: Identify one The two distinguishing features of the group known as catarrhines are…
A: Lemurs from Madagascar, lorises from Africa's Continent, and galagos from tropical Asia make up the…
Q: Identify the following features of the mandible: 1) 2) 3) 4) 5) What does "postcranial" mean? What…
A: Introduction The system that makes the internal framework of the human body is termed the…
Q: How will the cell shift its metabolic processes in response to the level of pyruvate and in order to…
A: Cellular respiration is the process by which energy is captured from food in three main stages. They…
Q: Viruses are composed of which type of genetic material inside of a protein shell? a. Not all…
A: Introduction :- Large biomolecules and macromolecules known as proteins are made up of one or more…
Q: Under stressful conditions epinephrine is released from the adrenal medulla. The release of…
A: Introduction :- Epinephrine, sometimes referred to as adrenaline, is a hormone and medicine that…
Q: You have two mutants of pQE. 1-CRYGD. One is 66 ng/uL and the other is 337 ng/uL. You need to add 1…
A: Introduction A mutation is a change in the nucleic acid sequence of an organism's, virus's, or…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: Given , A population consists of 300 individuals with the following genotypes: AA – 100…
Q: What is an ethical use of prenatal screening and pre-implantation screening
A: Preimplantation genetic diagnosis (PGD) is an alternative to prenatal diagnosis; it is suitable for…
Q: O It has evolved under strong negative selection in humans O Possession of the allele results in a…
A: The presence of BRCA1 gene is an indicator of breast, ovarian and pancreatic cancer. It is actually…
Q: 10 miracles of breathing
A: Breathing is a process of two major phases which are inhalation and exhalation. During inhalation…
Q: Fill-in the blank A person who is heterozygous for sickle-cell anemia a. has the disease b. C. does…
A: The recessive allele (written in small characters) is obscured in the presence of the dominant…
Q: What are the neuronal and muscle properties that support the size principle of recruitment?
A: The size principle states that depending on the intensity, the smallest to largest motor units will…
Q: Experiment # Growth Condition plus 0₂ minus 0₂ plus O2, plus cyanide* 1 2 3 cyanide stops the…
A: Cellular respiration is a multistep metabolic pathway involving the metabolism of glucose in the…
Q: What is the primary use of the antiviral drug acyclovir? Using terms already covered in class,…
A: What is primary use of the antiviral drug Acyclovir? Describe its mechanism of action.
Q: Why is it so important to not vortex and/or pipette vigorously after you lyse the cells during the…
A: Mini prep is a protocol used in the isolation of bacterial plasmid DNA. It is a very rapid technique…
A congenital defect mutates the genes that code for RAG1 & RAG2 making them unreadable (therefore no RAG1 or RAG2 production). Will this person still be able to produce B cells? Why or Why not?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- DiGeorge syndrome is a congenital disease that results in a poorly developed, nonfunctioning thymus gland. Which of the following would be a likely problem experienced by a baby with DiGeorge syndrome? a. lack of B cells b. lack of antibodies c. lack of T cells d. lack of macrophagesActivated helper T Cells participate in which of the following processes? a.) Differentiation of memory B cells b.) Activation of cytotoxic T Cells c.) Facilitation of macrophage phagocytosis d.) All of aboveWhich of the choices is required to activate a helper T cell, which in turn can stimulate antibody production by B cells? A)An antibody displayed by a major histocompatibility complex protein B)A major histocompatibility complex protein alone C)An antigen displayed by a major histocompatibility complex protein D)An antigen alone
- What are two types of long-lived cells derived from the B cell lineage? Where are these cells located + what is their function?At what stage of B cell development are autoreactive cells removed? A. stem cell stage B. pro-B cell stage C. early pre-B cell stage D. late pre-B cell stage E. immature cell stageBriefly, what are the 2 ‘checkpoints’ in development for the B cell? When do the B cells pause to proliferate and why is this step is important? Explain receptor editing.
- B cell receptor diversity is behind our ability to fight new infections. However, epitope-specific B Cell memory is critical for the secondary immune response protecting against new infections. You are ready to integrate concepts. In this question, you will combine B Cell receptor diversity and cloning! Please answer each question in less than 150 characters (including spaces). 1.Can a mature B Cell produce an epitope-specific antibody first and then switch to make an antibody against a different epitope? Explain. 2.Please describe what is transferred into an egg during cloning by somatic nuclear cell transfer. 3.How many B Cell receptors/antibodies could be generated in a mouse cloned by somatic nuclear cell transfer from a mature B Cell (after recombination)?The genetic content of each somatic cell in an organism is the same, but not all genes are expressed in every cell. Why can't cells express all the genes they have?Which of the following statements best explains why the immune system can continue to make antibodies after treatment with the anti-CD20 antibody rituximab? a. New CD20-positive B cells are reconstituted so quickly that antibody concentration during and after treatment is unaffected. b. Rituximab stimulates B-cell proliferation, so for a short while after its administration there is actually an increase in antibody concentration. c. Rituximab is a mouse monoclonal antibody and therefore its Fc region is unable to bind to the surface d. Plasma cells do not express CD20 on their cell surface, and antibody production by these cells continues unhampered. e. Rituximab stimulates anti-antibody production, leading to its rapid clearance by the body.
- of the choices, which cells stimulate directly B cells to divide and produce antibodies? a. mast cells b. marcophages c. Nk cells d. TH cellsExplain why each choice (a-d) is correct or incorrect. T cells are differentiated into two groups based on their glycoproteins CD4 or CD8. Which of the following is true of CD4 T cells? a. They become cytotoxic T cells. b. The become antigen presenting cells. c. They become T helper cells. d. They become plasma cells.In which cells are the enzyme TdT actively functioning? (select all that apply) Select one or more: a. immature B cells b. plasma cells c. hematopoietic stem cells d. pro-B cells