a. The reading frame DNA sequence is:b. The mRNA sequence is:c. The polypeptide sequence is:A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of mutation was produced?The mutated polypeptide sequence is What kind of mutation was produced? File: gvf11b11.y1Machine: Cochise-1414-017MatrixLane: 93Primer: DT3730POP7{BDV3).mobComment: 1778D3Spacing: 15.06Signal: C: 1728 A: 3254 G: 2538 T: 2619Bases: 903Gel name:Gel start date: 3 Jan 2004Gel start time: 4:1231020304050607080NNACTCA TCTGGTGGA TTC C TA TC CTG AC A AG TG ATGTG CAAA C TG G TAACTC TG AG GCAG A TAAC CA G GG CA AA AAG GTG TATAAG12013015090TAAA ACA AAGCCTAACT TG GAAGAAAGAGAGAAA A AGT TCA G TT TTACACA TCT TTA TA TGAAGCAGA AG TC CG GA AA A TCA TT TA A AGAT100110140160170210240250180TAT TCTAT TA ATGTCCTGT TA TA TT TG T CATATTCA TA CAGT TG TCACAGTA TA T T TCAAAC CA AC TG TTTAAA A ACAA AC TG AAA TA AA190200220230260270AAATTTAAA TACCCT TA TG TA AA ATAG GCT TC CCTGGTG GCTCAG GG GTAAA AA ACTCGCCCG C CA ACGCAGGAGATGTAGAT TTGATC CC T280290300310320330340350360370380390400410420430440GG GT TAG GA AGATCCCCTG GAGA AGGAAATGAAAAAC CACTCTAGTATTCTTGC CTG GG A A AT C CCATGGACAG AG GAGCGTGGAGG GC450TACAGTCCATGGGAGTCGCAAA AGAGT TG GACATG ACTAAACAACAACATATAAAATAACCT TACTCCATAATGTCAAACT TATGTCACAC460470480490500510520530620540AAAATGCA A AGT TCT TACATCTATTA ACTTTTATGGT TA AATATAACCTAATGCACTGTTT TATACAGCAACAACTACTTTTT TATTT TAAA550560570580590600610630650660720TG GTGAAA AAT TAGTGA ACAGAGGGT CTCAGAGATGCTAAACT TATGACT TATAAT TAACAAGATGTTATAGTTCTAGACAT TT TTGATAT640670680690700710Wan

Mutations are sudden changes that occur in the genetic sequence of an individual. There are various…

A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of mutation was produced? The mutated polypeptide sequence is What kind of mutation was produced?

A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of mutation was produced? The mutated polypeptide sequence is What kind of mutation was produced?

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter10: Reconstitution Of Powdered Drugs

Section: Chapter Questions

Problem 7.2P

See similar textbooks

Similar questions

Your pharmacy has on hand Tetracycline 250 mg/5 mL liquid.You receive a prescription for Tetracycline syrup 500 mg qid for 7 days. How many total milliliters would you dispense? Your pharmacy has on hand Prednisone 5 mg tablets.You receive a prescription for Prednisone 5 mg ii tabs stat and qid x 1 day, then ii tabs tid x 2 days, then ii tabs bid x 2 days, then i tab tid x 3 days, then i tab bid x 3days, then i tab qd x 4 days How many tablets would you dispense for this prescription? How many days will the patient take this medication for? Your pharmacy has on hand Dilantin 100mg capsules.You receive a prescription for Dilantin 100 mg 1 cap po in the AM & PM, 200mg (2 caps) po at noon, and 300mg (3 caps) po at hs. Dispense a 30 day supply. (using the 100mg capsules you have in stock) How many capsules will you dispense? Your pharmacy has on hand Dakins Irrigation Solution 1 liter.You receive a prescription for Dakins Irrigation Solution Irrigate chest tube with 100 mL…
Order: streptomycin 500 mg IM daily for 8 days. If you have vials of this antibiotic that are labeled as 1 g/2.5 mL, how many milliliters would you administer?
Please help Can wearing a mask, limiting public spaces capacity, and having travel restrictions be justified because of Covid-19? Just a question not a writing assignment.
You have an order for 1 gram of Cefazolin in D5W 100 ml. You have added 5 ml of sterile water to the 1 gram vial to reconstitute powder. However the recommended manufacturer’s diluent amount is 10 ml of sterile water for a final concentration of 100 mg/ml. How would reconstituting the vial with 5 mls affect the concentration and the final calculated dose. Please answer with explanation ASAP. I will really upvote. Thanks
The prescription requires 15 1g suppositories, containing 50mg of the drug to be produced. You prepare 20 suppositories. The displacement value of the drug is 1.5.How much base is required? (Give your answer to one decimal place) The following equation can be used:Amount of base required = theoretical amount – displaced amountWhere; Displaced amount = (amount of drug in g/DV of drug). unuit:g
Which dosage of polyethylene glycol is correct 17g,17.2 mg,10 mg ,15mg
The dosage strength available is 25mg in 1.5 ml. A dosage of 20 mg has been ordered. 25 mg : 1.5 mL= 20mg : X mL (solve for X)
Order: Ampicillin (Principen) 150 mg, PO, q6h Using the following drug label, how many milliliters of ampicillin will you give? __ mL Round your answer to the nearest whole number.
Which of the following pairs are pharmaceutical alternatives? Amoxicillin 250 mg capsule and Erythromycin 200 mg capsule Tetracycline HCl 250 mg capsule and Tetracycline phosphate 200 mg capsule None of the choices Ibuprofen 200 mg soft gel capsule and Paracetamol 500 mg tablet
The order is for Ceftin 0.25 gPO, bid. On hand you have Ceftin 125mg tablets. How many tablets should you give?
Give typed full explanation Methyldopa is ordered for a pediatric patient at a dose of 450 mg IV q 6 hr. The safe dose range is 20-40 mg/kg/day. The patient weighs 21 kg. Is this medication order safe?
You are administering tramadol to your patient. The order is for 600 mg. There are (3) concentrations available: a 300 mg/tab; a 200 mg/tab and a 100 mg/tab. Which concentration would be your best choice? How many tablets will you give? Group of answer choices a. 100 mg/tab; give 6 tablets b. 300 mg/tab; give 2 tablets c. 100 mg/tab; give 1 tablet d. 300 mg/tab; give 1/2 tablet e. 200 mg/tab; give 3 tablets f. 200 mg/tab; give 1/3 tablet