a a) In an experiment, you have changed a DNA sequence directly upstream from a startcodon of an operon in E.coli. The reason is to investigate the function of this region ofthe DNA. The analysis revealed that after the changes, the same amount of mRNA ismade from the operon, but very few proteins are being produced. What is the most likelyDNA region that you have changed, and what is the function of this region?b) The lacZ gene, which encodes for the expression of B-galactosidase during lactosemetabolism, depends very much upon the presence or absence of lactose in theenvironment. In an experiment, you have introduced cellobiose, an analogue of lactosewhich also acts as an inhibitor of the enzyme, to study its effect on B-galactosidaseactivity. What do you foresee to observe, in relation to lactose metabolism?

The question says that transcription is not affected but translation is. Therefore, some sequence…

a) In an experiment, you have changed a DNA sequence directly upstream from a start codon of an operon in E.coli. The reason is to investigate the function of this region of the DNA. The analysis revealed that after the changes, the same amount of mRNA is made from the operon, but very few proteins are being produced. What is the most likely DNA region that you have changed, and what is the function of this region? b) The lac7 gene which encodes for the expression of B-galactosidase during lactose

a) In an experiment, you have changed a DNA sequence directly upstream from a start codon of an operon in E.coli. The reason is to investigate the function of this region of the DNA. The analysis revealed that after the changes, the same amount of mRNA is made from the operon, but very few proteins are being produced. What is the most likely DNA region that you have changed, and what is the function of this region? b) The lac7 gene which encodes for the expression of B-galactosidase during lactose

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 9TYU: A mutation that inactivates the repressor gene of the lac operon results in (a) the continuous...

See similar textbooks

Similar questions

The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
A lac operon containing one mutation was cloned into a plasmid, which was introduced by transformation into a bacterium containing a wild-type lac operon. The three genes of the chromosomal operon were rendered noninducible in the presence of the plasmid. (a) What kind of mutation in the plasmid operon could have this effect? (b) Suppose the result of transformation was to cause the three plasmid lac genes to be expressed constitutively, at a high level. What type of plasmid gene mutation could have this result?
The lac operon produces enzymes that allow the bacteria E. coli to metabolize lactose, it is in an inducable operon. When lactose is present, will the repressor protein attach or leave the operon? How would this effect the production of lactose producing enzymes?
How will transcription of the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA? - Changing several nucleotides in region 3 so that in can base pair with region 4 but not with region 2 - Removing region 4 - Increasing the distance between region 2 and region 3 - Increasing the distance (number of bases) between the leader peptide gene and region 2
A mutation occurs in the 5′ UTR of the trp operon that reduces the ability of region 2 to pair with region 3. What will the effect of this mutation be when the tryptophan level is high? When the tryptophan level is low?
. Listed in parts a through g are some mutations that were found in the 5′ UTR of the trp operon of E. coli. What will the most likely effect of each of these mutations be on the transcription of the trp structural genes? Q. A mutation that changes the Trp codons in region 1 of the mRNA 5′ UTR into codons for alanine
If the two trp codons in the leader sequence were mutated to stop codons, what effect would it have on gene expression of that operon.
If you make a large deletion in the lac operon to remove the operator region, will the structural proteins of the lac operon be made?
1. a) If glucose is not available and lactose is absent from the environment, what is the status of transcription of the lac operon genes? Explain your answer from both an evolutionary perspective and in terms of negative and positive regulation of the operon? b)If glucose is not available, but lactose is available from the environment, what is the status of transcription of the lac operon genes? Explain your answer from both an evolutionary perspective and in terms of negative and positive regulation of the operon? b)
A mutant strain of E. coli has a premature stop mutation in the lacZgene, resulting in a non-functional b-galactosidase. Otherwise, all other parts of the operon are functional. Which component of an F' plasmid will restore normal regulation and function of the lac operon in the resulting partial diploid?
Listed in parts a through g are some mutations that were found in the 5′ UTR of the trp operon of E. coli. What will the most likely effect of each of these mutations be on the transcription of the trp structural genes? a. A mutation that prevents the binding of the ribosome to the 5′ end of the mRNA 5′ UTR b. A mutation that changes the Trp codons in region 1 of the mRNA 5′ UTR into codons for alanine c. A mutation that creates a stop codon early in region 1 of the mRNA 5′ UTR d. Deletions in region 2 of the mRNA 5′ UTR e. Deletions in region 3 of the mRNA 5′ UTR f. Deletions in region 4 of the mRNA 5′ UTR g. Deletion of the string of adenine nucleotides that follows region 4 in the 5′ UTR
In E. coli, the trp operon is on by default, while the lac operon is off. Why do you think that this is the case?