) A moose is an example of an organism that is large, lives relatively long, and has long generation types. Why do moose experience less population fluctuation than rabbits? 2) What is the primary driver of population cycles

Q: What is the probability that two heterozygous parents will have two homozygous recessive offspring?…

A: Probability is the likelihood that something will occur. When uncertain about the result of an…

Q: A 25-year-old soldier suffers a gunshot wound on the lower part of his back and is unable to move…

A: Cauda equina or conus injuries have the potential to cause lower motor neuron damage. A bundle of…

Q: The underlying structure of DNA is very simple, consisting of only four possible building blocks. a.…

A: DNA holds an individual's genetic information, as stated in the introduction. Phosphate, nitrogenous…

Q: Beriberi is caused by over-eating white rice because white rice contains Thiamine, a toxic compound…

A: Vitamins are the organic compounds,which is very important for performing cellular functions.They…

Q: A genomic library was made for a various ethnic groups, what do you think how can these data be of…

A: A genomic library is considered to be a collection of the fragments that can form the complete…

Q: RNA shares with proteins the ability to fold into complex three-dimensional shapes. As a result, RNA…

A: DNA (deoxyribonucleic acid) and proteins are arranged into chromosomes, which control how DNA is…

Q: Discuss amongst yourselves the ethical principles at stake when faced with a moral dilemma and the…

A: HIPPA Law: HIPPA law is an act that is referred as Health Insurance Portability and Accountability…

Q: Health impact of digestive disorders Drag and drop each cause to the correct disorder. May be caused…

A: Heartburn:  Maybe caused by reaction to medication. Maybe caused by overeating  Ulcer:  Maybe…

Q: High salt concentrations tend to cause protein aggregation. Suggest a way to identify proteins…

A: Introduction: Small, microscopic organisms are well-defined and usually described as known as…

Q: Why do microorganisms differ in their pH requirements for growth?

A: Microorganisms It is a microscopic organism that can exist as a colony of cells or as a single cell.…

Q: Why do scientists think that all forms of life on earth have a common origin?

A: Darwin's theory of common descent is that all species of life have descended from a common ancestor.…

Q: How can Western blot analysis build in the finding of Encoding of Temporal Signals by the TGF-b…

A: In genetics and biochemistry there are several components and wiring of the signaling pathways that…

Q: A 45-year-old man complains of shooting pain down his right leg that worsens with sitting and…

A:

Q: Type 2 diabetes mellitus is a common condition whose incidence is increasing worldwide, and for…

A: ( a ) : The research method in the above study involved is Diet Survey followed by the Diabetes…

Q: CLASS AMPHIBIA-SALAMANDERS, FROGS, & TOADS The hind limbs of the frog are much longer than the…

A: A frog is a tailless, short-bodied amphibian belonging to the big carnivorous group of species. A…

Q: Y-linked 이마 In the pedigree shown, indicate whether each of the following inheritance patterns is…

A: Autosomal dominant are effected parent in l generation.     Y linked traits are related

Q: Transcribe the strand below: ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG

A: The initial stage of gene expression, transcription, uses information from a gene to build a…

Q: 3. The total number of cells in a human adult body (70 kg) is estimated to be 40 trillion. How many…

A: The total no of cell in mouse of 70g is 40 million

Q: In a gorilla population in Zaire we consider a single gene locus with two alleles G and g, with G…

A: The Hardy-Weinberg formula is written as follows: p2 + 2pq + q2 = 1. Here, p represents the…

Q: What does the genome of mammalian mitochondria contain A total of 37 genes Genes for proteins used…

A: Introduction The little circular chromosome present inside mitochondria is known as mitochondrial…

Q: 8. Observe the sex-linked pedigree provided here that is tracking the red-green color- blindness…

A: Red green colorblindness is a disorder in which person is not able to distinguish between red and…

Q: Males have hemophilia when they are hemizygous for a nonfunctional recessive mutant allele of the…

A: Introduction: An X-linked genetic disorder called hemophilia causes improper blood clotting. The…

Q: In which of the three types of co-IP, the antibody elutes with the protein of interest and its heavy…

A: Co-Immunoprecipitation is a technique that relies on the immobilization of antibodies against a…

Q: Which is mandatory for speciation to occur?    • reproductive isolation • migration •divergence in…

A: Definition of speciation: Speciation is basically evolution of multiple species just from one…

Q: Plant bio

A: In the initial step of photosynthesis, solar energy is transformed into chemical energy in the form…

Q: An important evolutionary innovation and a major difference between the limbs of extant lobe-finned…

A: The scientific theory of evolution by natural selection was first proposed by Charles Darwin in…

Q: what is Gleevec ? What does it Target in cancer cells ?

A: Gleevec also known as Imatinib is a drug that are useful to treat different types of cancer such as…

Q: Briefly describe what an ecological disturbance is and provide an example.

A: Ecology is the branch of biology that deals with the relations of organisms to one another and to…

Q: QIESTION • Describe how do they engineer T cells to be used to succesfully treat cancer? • What are…

A: The second greatest reason for death worldwide is cancer. Any of the several illnesses characterized…

Q: Animal diversity in feeding habits Drag and drop each example to the correct class of animal. Simple…

A: Digestive system is responsible for the digestion, absorption and assimilation of neutrons in the…

Q: The stability of eukaryotic mRNAs can generally be enhanced by which of the following? Presence of…

A: The mRNA (messenger RNA) is used in the translation process for the production of proteins…

Q: 1. The most abundant protein found in the extracellular matrix (ECM) is A. elastin B. keratin C.…

A: Introduction :  Collagen, enzymes, and other large macromolecules form the extracellular matrix,…

Q: Genome sequences show that some pathogenic bacteria contain virulence genes that promote disease…

A: Lateral gene transfer (also called horizontal gene transfer) has played an important role in…

Q: T.Taking too much carbohydrates increases a risk of death in human. Thus, completely avoiding…

A: I totally agree that too much carbohydrates increases a risk of death in human.This is beacuse carbs…

Q: A raw wastewater is chlorinated before discharging into the environment. Due to potentially high…

A: The MPN is the most probable number. This is the test used to identify the most probable number of…

Q: What elements among CHNOPS make up DNA and RNA?

A: Biopolymers and macromolecules called nucleic acids are necessary for all known forms of life. They…

Q: According to the text and figure 2, which statement accurately describes relationships among…

A: According to Figure 2,

Q: The risk of Cancer increases as body mass increases. Determining right and wrong

A: Cancer:  The uneven multiplication of cells inside the body which can, later on, evade the…

Q: what molecule beside carbohydrates do plants need to grow?  7 what are they? 7 where do they come…

A: Answer: Plants : Plants are the living things on earth and they need certain molecules with sunlight…

Q: Give the interferences that may give false positive and false negative results in the determination…

A: Urinalysis is the process of testing the urine. The appearance , concentration and the contents of a…

Q: what is most likey the color of the urine of a patient wiith diabetes mellitus How can a…

A: The colour of the urine in patients with the diabetes mellitus appears cloudy and white. It is due…

Q: Compare and contrast drugs used in treament of heart failure.  Provide mehcnaims.  650 words

A: Heart failure is the condition in which the heart fails to pump blood to the body. Common symptoms…

Q: The mutant FMR-1 allele that causes fragile X syndrome is considered to be X-linked dominant with…

A: A genetic condition is fragile X syndrome. It causes a number of developmental issues, such as…

Q: 5 Examples of adult cytogenetics test and applications

A: Cytogenetics is the branch of genetics deals with the study of chromosome abnormalities like…

Q: What is the map distance between the two rapid lysis mutations rª and rª given the data below? re- X…

A: Identifying the recombinant frequency in the cross can help in identifying the map distance between…

Q: A) According to your results, why did some samples have more than one band of DNA? B) Results: Size…

A: DNA is the genetic material of the cell. It consists of double strands and is made up of a sequence…

Q: hich type(s) of cell division (mitosis, meiosis I, meiosis II) reduce(s) the chromosome number by…

A: Introduction: Chromosomes are the DNA's compressed form. There are a set number of chromosomes in…

Q: How many chromosomes were present before mitosis?  How many chromosomes did each of the daughter…

A: 1 answer - There are 46 individual chromosomes in each cell. With 92 individual chromatic are…

Q: Short tandem repeats are repeated sequences of DNA that code for proteins and are not unique within…

A: A standard molecular biology technique called short tandem repeat (STR) analysis is used to compare…

Q: 1. Which best describes the mode of inheritance of the afflicting allele in the following pedigree?…

A: Inheritance pattern is a phenomenon which determines hows traits are passed on from one generation…

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.