A peptide is produced in two different cells. The primary structure is the same in both cells, but the amount of peptide is increased in one cell. What could be happening to the pre-mRNA or mRNA transcript within the cell that has the higher amount of this peptide? A. It has a shorter Poly-A tail B. An alternative polyadenylation (Poly-A) site is being selected C. Leaky scanning occurred D. B and C are both correct E. None of the above.

Q: To which other species of storm-petrel is H. matsudairae, the cold-season breeder on Japan, least…

A: This is a representation of a phylogenetic tree in which different evolutionary relationships are…

Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…

A: Mutation is the change in DNA sequence or the number of chromosomes in an organism. In some cases…

Q: Transmits sensory signals to the CNS Group of answer choices dorsal root gray commisure ventral root…

A: Transmits sensory signals to the CNS given optionsdorsal root gray commissureventral rootventral…

Q: Why is cytosolic K+ highly concentrated when the extracellular K+ concentration is low even though…

A: The concentration of potassium ions (K+) inside a cell's cytosol is a finely regulated phenomenon…

Q: There are plenty of different phages that will kill Pseudomonas aeruginosa bacteria.  Why did the…

A: Note:- Sorry, as per the honor code, referring to external citations is not allowed. However, we…

Q: In the three different energy systems, name the energy compounds, and which systems are stressed…

A: In exercise physiology, there are three primary energy systems that the body utilizes to produce ATP…

Q: Describe how NADH transfers electrons to electron transport proteins of the ETS and ultimately to…

A: According to the guidelines of Bartleby,"Since you have posted multiple questions, we will provide…

Q: Metformin is a commonly used treatment for type 2 diabetes. The active compound was isolated from…

A: Metformin primarily lowers blood glucose levels by reducing liver glucose production, improving…

Q: Tarsiers are primates with unusual anatomical characteristics whose taxonomic classification has…

A: Tarsiers exhibit a blend of both ancient and advanced features. This mix, known as mosaic evolution,…

Q: fossil of what you think is the common ancestor of the new species of ape and all other gorillas.…

A: The whole branch of biology which deals with  establishing the relationship between two species is…

Q: Chi Squared Problems   In the garden pea, yellow cotyledon color is dominant to green, and…

A: Total number of Phenotypes obtained- 556 + 193 + 184 + 61 = 994In order to calculate expected…

Q: el Which of the following is a comma-shaped, Gram-negative bacterium that acts as a predator on…

A: Bacteria are relatively simple, microscopic and prokaryotic organisms which lack nucleus and other…

Q: A population of llamas exhibits Type I survivorship. It has a nice life span and but fewer…

A: The collection of all the interacting individuals of a species that are located in a particular area…

Q: cross between two heterozygotes fruit flies with purple eyes and white bodies (EeBb) results in 4…

A: Parent 1: EeBbParent 2: EeBbEye color : EeHomozygous dominant (EE): Purple eyesHeterozygous (Ee):…

Q: 27) If the sequence TCGTA was used as a template in DNA replication, what would the sequence of…

A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…

Q: A mother with blood type A has a child with blood type AB. Give all possible blood types for the…

A: The most commonly used blood group system is the ABO system, which categorizes blood into four…

Q: 2. The following is the sequence of a gene encoding a small protein: GG (d) 5'…

A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…

Q: Which of the following correctly matches the stage of cellular respiration with its location within…

A: A key metabolic process called cellular respiration takes place in the cells of all living things,…

Q: Rank these amino acids from most to least hydrophobic. COO™ COO™ çoo

A: Think of amino acids as characters in a story. Leucine is the 'shy' one who avoids water, so it's…

Q: Give typed full explanation  Which of the following results in the production of ATP from ADP? a.…

A: ATP is adenosine triphosphate which is the source of energy for the use and storage at the cellular…

Q: Most eukaryotic genes are normally inactive and require positive regulation. Determine whether the…

A: In eukaryotes when genes need to be turned on and transcribed into m RNA and proteins, this process…

Q: The ______ controls most of the autonomic nervous system functions and is considered the main…

A: The diencephalon of the brain contains the hypothalamus, which is a crucial regulatory region for a…

Q: Which of the following is NOT a deuterostome? O Shark O Spider O Sea urchin Sea turtle

A: In the diverse world of animals, there are distinct developmental patterns that classify them into…

Q: Define half velocity constant. What is its significance in terms of substrate consumption? In other…

A: In enzymology, the idea of the half-velocity constant, frequently abbreviated as Km, is crucial. It…

Q: Is an automatic drinking bowl for pets that stops dispensing water when it reaches the right level a…

A: Feedback occurs when the output or response of a loop influences or impacts the input or…

Q: 1. Will glycolysis be useful for the metabolism of maltotriose? (Yes or No) Yes 2. When grown…

A: Given , that the organism is ,Positive for glucose fermentation.Capable of making all of the enzymes…

Q: Match the organelle/cellular component to its function: Contains enzymes that break down and digest…

A: 1.Cystosol - jelly like fluid inside the cell2. Ribosome - helps in synthesis of proteins.3. Smooth…

Q: See image

A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: a) 1. What is the theory upon which intermittent sterilization is based? (B) Is dry or moist heat…

A: In the field of microbiology, various sterilization methods and laboratory techniques play a crucial…

Q: 2.3. Locomotor and Bladder Function Locomotion scores in all dogs gradually increased with the…

A: In Figure 3, the gait ability and locomotion scores for four dogs are presented:

Q: How can a skull of a specimen be classified as a Catarrhine?

A: Catarrhines are primates that have their nostrils close together or are narrow-nosed as opposed to…

Q: 16-year-old brought into the ER via private auto. He walked into another player swinging a baseball…

A: The type of fracture that a 16-year-old has experienced can be one of a few types, depending on the…

Q: be used more than once. Below the lists, several transport scenarios are described. For each…

A: There are few substances found outside the cell and few inside the cell. Some substances are needed…

Q: Determine whether Staphylococcus saprophyticus and Serratia marcescens are gram-negative or gram…

A: On the basis of the staining procedure called Gram staining, bacteria can be classified as gram…

Q: Q4.6. Imagine a species whose eye color is determined by a receptor molecule called EyeC. When EyeC…

A: The question presents a hypothetical scenario about a species whose eye color is determined by a…

Q: edigree and determine which of the following modes of inheri ait: dominant recessive minant essive…

A: A pedigree is made on different modes of inheritance that could be autosomal or sex linked.…

Q: How do cells regulate enzyme activities?

A: Cells control enzyme activity in numerous ways to ensure that metabolic processes occur at the…

Q: sify the following statements into the correct category of HIV. Category A T cell count greater than…

A: HIV or human immunodeficiency virus causes AIDS in humans. HIV is a RNA virus. HIV virus attacks the…

Q: One reason that the osmolarity becomes higher at the bottom part of the loop of Henle is because A)…

A: Henle's loop is a long, U-shaped section of the kidney's nephron tubule found in mammals, birds, and…

Q: Which are functions of the male reproductive system? Select all that apply. Check all that apply. To…

A: The male reproductive system comprises the testes, which produce sperm and hormones such as…

Q: Draw a diagram/graph to represent the results of an experiment that would prove that there was…

A: Horizontal gene transfer is a method of gene transfer between two unrelated species. Here a…

Q: 3) A locus controlling stripe intensity in snakes is known to possess two alleles that are…

A: The problem at hand pertains to a genetic locus in snakes responsible for controlling stripe…

Q: Baker's yeast, Saccharomyces cerevisiae, is a single-celled, diploid fungus (which is, of course, a…

A: Note :- "since you have posted multiple questions we will provide the solution to the only first…

Q: A type of bird on an island makes nests in both tree roots and in tree branches at various heights…

A: Natural selection is an evolutionary mechanism. Organisms that are better adapted to their…

Q: What skeletal trait of P. cookie is different from modern primates?   A. P. cookie has no…

A: P. Cookie is an extinct primates and is similar to lemur.

Q: nzyme. So you want to assemble a gene and put it in the ants. Below is a schematic of the ant gene,…

A: Few important  terms .Plasmid :A plasmid is a small, circular piece of DNA that differs from a…

Q: Given the following media recipe, pick the terms that apply (pick as many as are applicable). 10.0 g…

A: The composition of media with meat extract, peptone, sodium chloride, agar, and water is a basic…

Q: draw the Rhizopus and indicate the hyphae, zygospores, and sporangia. (Rhizopus combination) draw…

A: The Kingdom Fungi includes diverse eukaryotic organisms including molds, yeasts, and mushrooms.…

Q: The path of whale evolution has involved the reduction or loss of several traits that are still…

A: Whales, unlike their terrestrial mammal counterparts, lack the ability to smell underwater. This…

Q: The Swedish Botanist Carolus Liññáéus is recognized as the firs regarding the work of Linnaeus is…

A: Option 1: Linnaeus' work followed other Naturalists but his work was deemed unifying and so he…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.