Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA?   b. What dipeptide is formed if a point mutation converts CUU to CUC?   c. What dipeptide is formed it a point mutation converts CAG to AAG?

Q: The following questions refer to this diagram of a mature mRNA. 1) Which two sequences shown in…

A: mRNA is messenger RNA that takes the message of a gene from DNA and then converts it into protein.

Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…

A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…

Q: What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap…

A: The predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’…

Q: How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fully…

A: DNA and RNA differ in only one of the four nitrogenous bases. RNA has uracil instead of thymine. DNA…

Q: Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2…

A: Proteins are obtained from DNA that contains the required genetic information. DNA is first…

Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…

A: Disclaimer: " It is assumed that the given coding strand is from 5' to 3' direction. The central…

Q: vell. A study on this organism found that two mature mRNA molecules are produced for this gene. One…

A: Few points to understand mRNA processing --- In prokaryotes transcription and translation occurs…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3.  What…

A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…

Q: One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why…

A: oligo(dT)are  primer widely used for cDNA the synthesis generation of a high frequency of…

Q: Describe in discrete steps how a polyadenylation signal contributes to the formation of a mature…

A: Answer: Introduction: Eukaryotic cellular process is regulated in the transcription process and RNA…

Q: Mutation of which of these sequences would have an effect on translational initiation?   A. 3’ UTR…

A: Introduction  Prokaryotic transcription is the process by which prokaryotic genetic material is…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: The mRNA coding for the Ionotropic glutamate receptor undergoes RNA editing. Describe the process on…

A: Introduction : Excitatory neurotransmission in the brain is primarily mediated by glutamate, the…

Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…

A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Hemophilia -- It occurs in about 1 of every 5000 males .     Usually a inherited disorder in which…

Q: Which amino acid would bind if the mRNA read.... AGG? Ala (A) Ser (S) G A Lys (K) Asp (D) U ← Asn…

A: Once mRNA is produced, by transcribing and processing the information contained in the nucleotide…

Q: Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it…

A: Introduction:Gene is a region of DNA that encodes for proteins. DNA is transcribed into mRNA which…

Q: Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic…

A: Single base pair mutation in mRNA transcript in Eukaryotes is less serious because mRNA of Eukarotes…

Q: A nonsense mutation (a) causes one amino acid to be substituted for another in a polypeptide chain…

A: A nonsense mutation is defined as the process of the substitution of only a single base pair. This…

Q: In the triplet-binding assay of Nirenberg and Leder, an RNA triplet composed of three bases was able…

A: Introduction  In 1964, two eminent scientists Marshall W. Nirenberg and Philip Leder carried out the…

Q: Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the…

A: The protein is synthesized by the process of translation. It takes place in the cytoplasm of the…

Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…

A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…

Q: At least one nonsense suppressing tRNA is knownthat can suppress more than one type of…

A: tRNA is a transfer ribonucleic acid. It is a type of RNA which decodes the messenger RNA and form a…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…

A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…

Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…

A: Answer: Central dogma  replication----> transcription -------> translational  DNA-------->…

Q: A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that…

A: mRNA Messenger RNA or mRNA, it is a single-stranded RNA molecule that is coded into chain of peptide…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ This is an mRNA…

A: Answer: Introduction: The mRNA codons are read while translation, starting with a start codon and…

Q: What is the order of the tRNA binding sites on the 70S ribosome with respect to the 5' 3' direction…

A: Each ribosomal subunit has three binding sites for tRNA:  the A (aminoacyl) site, which accepts the…

Q: RNA silencing can be accomplished by specific MRNA degradation or by preventing its translation of…

A: RNA silencing or RNA interference is a post transcriptional gene silencing process.IT is an…

Q: Describe the significance of a 5 cap poly A tail on the mature mRNA

A: mRNA- is a coding sequence of a gene implicated in the synthesis of protein, approximately, 4% of…

Q: Which of the following help(s) to stabilize mRNA by inhibiting degradation?   a. Introns   b.…

A:

Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ ⦁ There are…

A: The process of translation is initiated by the start codon which is a nucleotide triplet situated in…

Q: Given the following coding strand of DNA: 3' – TACCGAGTACTGACT – 5', the mRNA that will transcribed…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. The copy,…

Q: double-stranded helix

A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…

Q: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of…

A: Selection of the AUG start codon for translation in eukaryotes is governed by codon-anticodon…

Q: We have a eukaryotic full-length mRNA molecule consisting of 33 bp…

A: translation is the process by which cell make proteins from mRNA . THIS process takes place in the…

Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…

A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices.  in…

Q: the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using…

A: In Prokaryotes; both Transcription and translation process takes place in the cytoplasm; but in…

Q: Another thalassemic patient had a mutation leading to the production of an mRNA for the β chain of…

A: Thalassemias are hereditary blood diseases in which hemoglobin synthesis is reduced. Thalassemias…

Q: Mhich of the following polypeptides is coded for my the MRNA sequence 5' AUGGUUAAACGACAAUCC 3 ?

A: The amino acids are selected and wrote in the sequence as first, second and third base. The process…

Q: What is the mechanism for addition of a guanosine to create the 5' methyl cap of a MRNA? O The 5'-OH…

A: Mature mRNA is an mRNA that is modified post-transcriptionally. Mature mRNA carries information from…

Q: tRNAs a. carry amino acids b. bind to the anticodon present in the mRNA c. adapt the genetic…

A: Introduction Transfer RNA (tRNA) is a short RNA molecule that aids in the production of proteins. A…

Q: In a study of  several families for differences in the sequence of a particular gene suspected to…

A: The mutation is the change in the nucleic acid sequence that alters the way the particular gene gets…

Q: A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate…

A: The central dogma depicts the replication of DNA, the transcription of DNA into RNA, and the…

Q: Identify the different regions of the mature mRNA by matching terms with regions. regions are shown…

A: Answer. Eukaryotic m RNA are mostly monocistronic having an average size of 1500 to 2000…

Q: Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid…

A: DNA => Transcription => mRNA => Translation => Protein. Given DNA sequence: 5' ATG CTT…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.