A pregnant woman is carrying a triplet inside her womb. They want to determine the number of boys or girls she is carrying but the sex of the fetus cannot be determined yet. What is the probability of having boys and at least a girl? A. 3a²b B. a³ C. b³

A pregnant woman is carrying a triplet inside her womb. They want to determine the number of boys or girls she is carrying but the sex of the fetus cannot be determined yet. What is the probability of having boys and at least a girl? A. 3a²b B. a³ C. b³

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter11: The Basic Principles Of Heredity

Section: Chapter Questions

Problem 5TYU: Assume that the ratio of females to males is 1:1. A couple already has two daughters and no sons. If...

See similar textbooks

Related questions

Q: 1 2 10 3 11 12 13 5 14 15 6 8 16 Figure 8.1 Muscles in the dorsal side of the frog

A: Soft tissues include muscles. Your muscles are made up of many flexible fibres.

Q: Genotypic Ratio: Phenotypes: Phenotypic Ratio: Rr Genotypes. Genotypic Ratio: Phenotypes: Phenotypic…

A: In order to explain the inheritance pattern Mendel gave three laws -law of dominance, law of…

Q: 4. Mr. Salazar has Type A blood while Mrs. Salazar has Type B. They have four children. Bobbie has…

A: Given - Blood type of Mr Salazar - A Blood type of Mrs Salazar - B Therefore, Possible genotypes of…

Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…

A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1 p is the frequency of the "A" allele…

Q: Gamma globulins is synthesized in the liver True false plasma lipid is synthesis in the Kidney liver…

A: Please follow steps 2, 3 & 4 for detailed explanation.

Q: 1. What are the major adaptations that allow nemertines to thrive in the marine environment? Support…

A: Adaptation: It is a process of evolution that allows any particular organism to be well suited for…

Q: 6. Which of the following statements best explains why cancer is so difficult to cure? O A. Each…

A: Cancer is a condition in which some cells in the body grow out of control and spread to other parts…

Q: Helen is a 62 yo smoker. Her physician has dignified her as having emphysema that has caused her to…

A: Given: Blood pH=7.40 To explain: To explain about pH level of a person and its effects

Q: Renal threshold for glucose is ---- mg/dl

A: In physiology, renal threshold refers to the concentration of a substance dissolved in the blood,…

Q: How does RhoGAM prevent HDN? A) it is an antigen that binds to and inactivates anti-Rh antibody from…

A: Introduction Antibody:- It is a protein made by plasma cells (a type of white blood cell) in…

Q: In the past, aspiring London taxicab drivers underwent a rigorous education that required them to…

A: The genetic material that makes up DNA is referred to as the "building block of life." Many…

Q: explain why it is important to maintain sterility when inserting a foley cathether

A: Foley's catheter is an indwelling catheter, i.e. it can be left in place for longer durations than…

Q: How large (as a proportion of body size) should the testes of chimpanzee males be relative to…

A: The testicles are responsible for making testosterone, the essential male sex hormone, and for sperm…

Q: 1. Summarize the blood level data with a frequency distribution. 2. Calculate the arithmetic mean.…

A: There are few important points to remember : Mean : It is defined as sum by number of its value .…

Q: what is the sun made of?

A: To explain: To explain about the sun and its composition

Q: 2. Many animals preferentially assist individuals with whom they are most familiar. Explain how such…

A: Introduction Kin refers to someone you are related to a member of one's family.

Q: Create a food web of an Urban Ecosystem (UTAH) 1. Include: producers, primary, secondary, tertiary…

A: An ecosystem can be defined as a functional unit of nature, where living organisms interact among…

Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Protein tyrosine phosphatases shows exquisite specificity for their substrates.

Q: Why is bush encroachment a common characteristic between Sweet and the Sour veld, veld types whereas…

A: A veld which is also commonly known as veldt is large landscape that is open and flat. Perennial…

Q: MECHANISMS EXAMPLES 1. 1. Geographical Isolation 1. 2. 2. Temporal/Seasonal Isolation 3 | 1. 2. 3.…

A: Ecological, temporal, behavioral, mechanical/chemical, and geographical isolation techniques all…

Q: Explain how Circulatory Systems works in a: Fish Prawn & Apple snail

A: Every cell, tissue, organ, and organ system in the body is fed by the circulatory system. The…

Q: Question: please provide your thoughts on whether or not melatonin seems to be a good option for…

A: Melatonin occurs naturally in both plants and mammals. Long associated with the regulation of the…

Q: All of the following are benefits of breast feeding EX a) The baby will receive complex…

A: In infants below 6 months of age, it's advised that breastfeeding is to be followed. Breastfeeding…

Q: Sign in Draw Design Layout References Mailings Review View Help Tell me what you want to do nswer:…

A: Polymer are made up of many monomers. The polymerization reaction allows the formation of different…

Q: Poverty and hunger drive people to bear more children. a) True b) False 35 0

A: Not 100 % true but it true...

Q: How does F1 Plant help farmers? Give atleast 5

A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…

Q: Each of the animal cells shown below is ina different stage of mitosis. Select the cell that is…

A: Mitosis is the process in which the sister chromatids separate from each other and move to opposite…

Q: Which of the following are characteristics of minerals? Select all answers that apply. Inorganic Not…

A: Introduction Minerals are necessary for your frame's well-being. Minerals are used by your body…

Q: 4. WATER HAS THE PROPERTY OF ADHESION, WHICH ALLOWS IT TO USE WHICH PROCESS IN PLANT ROOTS? A:…

A: Ans is.. capillary action

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: Rapidly dividing cells such as bone marrow, skin, intestinal mucosa, and cancer cells need DNA…

A: Cancer is a disease defined by the uncontrolled development of a group of abnormal cells that can…

Q: Explain the process of seed development in a typical angiosperm plant. 2. Describe the two -stage…

A: Angiosperms are flower-bearing plants and are the most diverse group of terrestrial plants. The…

Q: Give two examples of how forest fragmentation affects animals. How does island biogeography theory…

A: Forest fragmentation is the process by which forests are broken up into smaller and more isolated…

Q: The bond is found in protein and linked the amino acid is

Q: Give at least 5 observations from the structures based on fish dissection?

A: Given: For the fish dissection procedure one would require, Medium sized - fish to visualize all the…

Q: In a population of snapdragons, at the locus controlling flower color you find that 0.2 are AA, 0.65…

A: Given: AA = 0.2 Aa = 0.65 aa = 0.15 Need to find the inbreeding coefficient.

Q: What are 4 mutualistic and 4 antagonistic interaction between two or more species that are exploited…

A: Four mutualistic interactions- 1. Aphids and ants- Aphids are sap-sucking insects that exude…

Q: 4. Give at least 2 major contributions of Cambrian explosion to evolution

A: 4. The Cambrian Period is significant in the evolution of life on Earth since it is when most of the…

Q: Give the major factors that cause changes in the genotype and allele frequencies of a population…

A: Evolutionary mechanisms do not operate in isolation in natural populations. Conservation…

Q: 3 8 2. 5. 1. 6. 7,

A: A cell is the basic unit of life. All living creatures are made up of cells, ranging from…

Q: Phosphorylase kinase integrates signals from thecyclic-AMP-dependent and Ca2+-dependent…

A: Phosphorylase kinase which is abbreviated as PhK, has the responsibility to coordinate hormonal as…

Q: In a eukaryotic cell, the majority of the organelles are located in the: cell wall O coelom…

A: Eukaryotes are cells that are complex in structure and function As they have the membrane bound…

Q: Chromosomes align at metaphase plate equidistantly from the opposite pole to avoid unequal…

A: Metaphase It is the fourth stage of the division of the cell. It is the stage in which the…

Q: The erythrocyte sedimentation rate (heaviness) testis oftenusedfor a blood sample as a diagnosis of…

A: Erythrocyte sedimentation rate: The erythrocyte sedimentation rate (ESR or sed rate) is the rate at…

Q: 1. Male and female animals have a pair of gonads. What advantages does it provide to the species?

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Mike is a 34-year old male who reports to the ER after a motorcycle accident. MRI results show that…

A: In a person that has transected spinal cord injury between T1 and L1, it would have paraplegia.

Q: Which of the following is NOT a catalytic strategy used by trypsin? a. Acid-base catalysis b.…

A: Enzymes require an ideal pH range and temperature to operate properly. The tertiary structure of the…

Q: QUESTIONS FOR RESEARCH AND PROBLEMS 1. Give the major factors that cause changes in the genotype and…

A: The complete set of genetic material in an organism is known as genotype. It can also be referred to…

Q: Aside from cleanliness and access to clean water, propose scientific ways in controlling parasitic…

A: Parasitic diseases These are diseases that are caused by a parasite. These are infectious diseases…

Q: Explain the difference between Place and Stimulus-Response learning strategies. Include the…

A: The activation of Brain sources that occur in response to auditory, visual and audiovisual stimuli…

Question

A. 3a²b

B. a³

C. b³

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If a couple has six boys, what is the probability that a seventh child will be a girl?
“If two sets of identical twins get married and each couple has a child, could the resulting children be identical?”
Tarzan and Jane both have a widow’s peak. Is it possible for them to have a child without one? Explain.
Suppose a man who does not have Duchenne muscular dystrophy had a child with a woman who is a carrier of the disease. If the child is a female, what is the probability that she has the disease? a. 0% b. 25% c. 50% d. 75% e. 100%
Suppose that two people having free earlobes start a family. Their first child has free earlobes and their sec- ond has attached earlobes.a. What are the genotypes of the parents? ________b. What is the genotype of their first child? ________c. What is the genotype of their second child? ________
Two parents with blood types AB and B have a child who has A blood type. What is the chance that their next child will be blood type O? a 0 b 1/2 c 1/4 d 1 e 3/4
Use the Product Law and / or the Money Law to answer the following questions. If you have 3 children: a. What are the overall chances of having 3 daughters? b. How lucky are you to have 2 boys and 1 girl? (any order) c. How lucky are you to have a boy, then a girl, then a boy (in that order).
Create a Punnett square to illustrate the offspring that could result if Felix had children with a noncarrier woman. What is the probability that a son would have WAS? What is the probability that a daughter would be a carrier of WAS?
Could a man with an O blood type be the father of an AB child? and why?
Assume that the ratio of females to males is 1:1. A couple already has two daughters and no sons. If they plan to have a total of six children, what is the probability that they will have four more girls? (a) ¼ (b) 1/8 (c) 1/16 (d) 1/32 (e) 1/64
If an albino woman married a normal man, one of whose parents was albino, what would be the chances of their first child being albino?
An ornage cat has a litter of four kittens: one orange, and three calicos. Assuming a single father for the litter, what is the sex of the orange kitten? show work