A severe fire or flood kills 90% of a population of squirrels in a forest. The remaining squirrels evolve into a population quite distinct from the original. In another forest, a bacterial infection kills 90% of the squirrels in the forest, and the remaining squirrels also evolve into a distinct population. The first instance is considered genetic drift, and the second is natural selection. Explain the difference.

Question

A severe fire or flood kills 90% of a population of squirrels in a forest. The remaining squirrels evolve into a population quite distinct from the original. In another forest, a bacterial infection kills 90% of the squirrels in the forest, and the remaining squirrels also evolve into a distinct population. The first instance is considered genetic drift, and the second is natural selection. Explain the difference.

 

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Evolution and Adaptation

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Why was it necessary to mash the strawberries extensively with your hands? (hint: you wouldn’t have ...

A: This is the process that is used for the extraction of DNA from the cell. DNA is present in the nucl...

Q: vivax is one of several malaria-causing Plasmodium species that form hypnozoites in the liver, which...

A: The malaria is the infectious disease transmitted by the mosquito bites. It is caused by the parasit...

Q: WHAT WOULD HAPPEN IF THE GREATER SCIATIC NOTCH OF THE ILIUM WERE ABNORMALLY SMALL AND NARROW

A: The skeletal system comprises all of the bones and joints in the body. Each bone is a complex living...

Q: One reason that worker bees forgo their own reproduction to help their sister (the queen) reproduce ...

A: In Haplodiploid behaviour female  are diploid and male are haploid.   Females  are diploid. They rec...

Q: Water for the water vascular system enters through the __________________.

A: The water vascular system is a hydraulic system used by echinoderms, such as sea stars and sea urchi...

Q: Describe how viruses replicate. Be sure to address the difference between lytic and lysogenic replic...

A: Viruses are microscopic infectious agent which consists of nucleic acid molecule in a protein coat. ...

Q: Organisms Habitat Virulence Pathology Other Gram (+) Bacilli - Sporeforming C. botulinum C. tetani C...

A: Clostridium are spore forming, anaerobic, fernentative organisms with different habitats. These orga...

Q: Which of the following arrythmias is characterized by extremely fast but coordinated contractions? G...

A: Arrhythmia is the condition referring to irregular heartbeats or alterations in the heartbeat. Most ...

Q: Which type of capillary would you expect to find in the brain? Group of answer choices Continuous Fe...

A: Capillaries: Capillaries are small blood-containing structures that join ventricles and arterioles.C...

Q: Sea Star  What is the function of the eye-spot?

A:  Eye-spot small red spot on the tip of each arm; sensitive to light.  These are light-sensitive cell...

Q: BIO 211 Bacteriology Self Study: Use your text and lecture notes as reference to complete the table....

A: the cocci group of bacteria are found in close association with humans and animals. most of the bact...

Q: The cellular division that changes the chromosomes ploidy from 2n to 1n occurs during what phase

A: Ploidy is the number of “complete sets of chromosomes” in a cell. According to the number of sets of...

Q: How do zoned reserves provide economic incentives forlong-term conservation of protected areas?

A: Zoned reserve includes an extensively large area of land, which consists of one or more areas that a...

Q: There are three modes of natural selection: stabilizing selection, directional selection and diversi...

A: Natural selection can be defined as the differences in the strategies of survival and reproduction t...

Q: Systems biology is mainly an attempt to(A) analyze genomes from different species.(B) simplify compl...

A: Systems biology refers to the mathematical and computational analysis and modeling of biological sys...

Q: please see attachment for question

A: Meiosis is a process of coordinated segregation of chromosomes into daughter cells. The total number...

Q: On which surface would you find the mouth?

A: The scientific anatomical terminology is utilized to refer to specific regions or parts of the body....

Q: Give a short note on phytophagous animals with example.

A: 'Phyto' means plant and 'phagous' means eater. So, phytophagous means plant-eater.

Q: Where does Tubular Reabsorption occur in the nephron?

A: Life processes are important for the sustenance of life of living organisms. Nutrition, transportati...

Q: Identify three things you need to know about an organism in order to use it for an experiment.

A: The organisms that are widely used for experimental purposes are called model organisms.

Q: Which of the following could increase a person’s risk of a heart attack? Group of answer choices Ane...

A: A heart attack is also known as myocardial infarction. It occurs due to the blockage of blood flow t...

Q: In preparing a site for surface mining and later restoration, why wouldengineers separate the topsoi...

A: Restoration ecology is a branch of ecology that deals with the restoration of the degraded, damaged ...

Q: Exocytosis Exocytosis (below) is an active transport process in which a secretory vesicle fuses with...

A: 2.a The main purpose of exocytosis to expel the contents of the cell into extracellular fluid. the c...

Q: In which one of the following animals is skin a respiratory organ?   A. CockroachB. FrogC. sharkD. W...

A: different animals can exchange gases through different respiratory systems such as, Through Body Wa...

Q: The sea star has ___________________________ symmetry.

A: A Starfish start out with bilateral symmetry during their larval stage. However, during metamorphosi...

Q: What holds the atoms together in a crystal of magnesiumchloride (MgCl2)?

A: Chemical Bonding is the process of formation of a chemical bond between two or more atoms, molecules...

Q: Are mollusc metameric beings? Exclusively analyzing this feature could it be said that molluscs are ...

A: The mollusks are a diverse group containing 85,000 species. These are mostly marine species.

Q: What practice is sometimes used to ensure that patients take all of their tuberculosis medication? W...

A: Tuberculosis is a bacterial infectious disease caused by Mycobacterium tuberculosis. This infection ...

Q: Explain how and why PCR can be used to amplify DNA. Describe the steps in the process. Be sure to ad...

A: PCR stands for a polymerase chain reaction. It is used to amplify the DNA segment. It can make many ...

Q: Why are the stone canal and madreporite hard while the rest of the water vascular system is soft?

A: Echinoderms like sea stars and sea urchins utilise water vascular system which is a hydraulic system...

Q: Epigenetics has been described as “inheritance, but not as we know it.” Do you think this is a good ...

A: Epigenetics is biology refers to study of phenotype change (heritable) which do not involved changes...

Q: This virtual lab was testing for lupus. How is this same test used to test for the presence of HIV? ...

A: Lupus is a disease in which the immune system abnormally becomes hyperactive and attacks the normal ...

Q: You are observing a species of mice in which brown fur color is dominant to white fur color. When a ...

A: Genetics may be defined as a branch of biology that mainly deals with the study of genes, genetic va...

Q: What could cause a healthy person to have a higher than normal resting heart rate?

A: Heart rates can vary from person to person. When the heart beats too rapidly, it pumps less efficien...

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom ...

A: The process of protein synthesis using the information in an organism's DNA is called central dogma ...

Q: Disscuss the importance of testing of new plant varieties in a geographically vast country like indi...

A: India is a geographically vast country with different types of soil and climatic zones. For the purp...

Q: How can the addition of excess mineral nutrients to alake threaten its fish population?

A: The excess mineral nutrient makes the water of the lake hypertonic than the fluid of the fish body.

Q: All the organisms on your campus make up(A) an ecosystem.(B) a community.(C) a population.(D) a taxo...

A: An ecosystem contains living as well as non living components which interact with each other. This o...