5. In the replication of a DNA molecule, two daughter molecules, S and T, are formed. The following basesequence is part of the "parent" strand in daughter molecule S: 5' TTCAGAG 3'. Indicate thecorresponding base sequence ina) The newly formed strand in daughter molecule T.b) The newly formed strand in daughter molecule S.c) The "parent" strand in daughter molecule T.

During DNA Replication new DNA strand synthesis occurs in 5' to 3' direction. As per Chargaffs rule…

Answered: a) The newly formed strand in daughter…

a) The newly formed strand in daughter molecule T. b) The newly formed strand in daughter molecule S. c) The "parent" strand in daughter molecule T.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 8TYU: The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is...

See similar textbooks

Similar questions

The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
1. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′ 2. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices a. C b. G c. A d. T 3. A scientist, Dr. Doom would like to create a novel antibiotic by targeting translation in bacterial cells. Which enzyme(s) would Dr. Doom need to target to prevent translation at the transcriptional stage? Group of answer choices a. RNA Polymerase…
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
#1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C. nitrogen bases D. new copied strand of DNA
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
1. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? a. C b. G c. A d. T 2. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′ 3. This complex assembles and organizes nucleosomes and contributes to gene repression a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 4. Amino acids at the N-terminal end of eukaryotic polypeptides that contain the information required for the post-translational processing and…
outline 4 differences between the leading and lagging strand of DNA replication
2. Describe what is meant be the antiparallel arrangement of DNA.
Describe in detail the semi Conservative replication of the DNA double helix structure
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?